We narrowed to 276 results for: gcamp6
-
Plasmid#67558Purposephotoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6f
TagsHIS-tagExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…PromoterCMVAvailable SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pJFRC7-syt1-GCaMP6f
Plasmid#190896PurposeGCaMP6f fused to Drosophila synaptotagmin1 via a 3x GS linker. In the pJFRC7-20XUAS vector.DepositorInsertsyt1-GCaMP6f
ExpressionInsectAvailable SinceNov. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
DF-UAS-spa-GCaMP6f
Plasmid#67568PurposeZebrafish expression of a photoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6f
UseZebrafish transgenesis (see :a spinal opsin contr…TagsHIS-tagMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Fast-GCaMP6f-RS06
Plasmid#67159Purposegenetically encodable fluorescent calcium indicator protein to monitor neuronal activityDepositorInsertFast-GCaMP6f-RS06
Tags6xHis, T7 tag, and Xpress tagExpressionBacterialMutationM374Q within GCaMP6fPromoterT7Available SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
RabV CVS-N2c(deltaG)-GCaMP6f
Plasmid#73466PurposeExpresses GCaMP6f for calcium imagingDepositorInsertGCaMP6f
UseNeurotropic virusAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSET-spa-GCaMP6f
Plasmid#67563Purposebacterial expression of a photoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6f
TagsHIS-tagExpressionBacterialMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GCaMP6f
Plasmid#249680PurposeExpresses GCaMP6f under the CAG promoterDepositorInsertGCaMP6f
ExpressionMammalianPromoterCAGAvailable SinceMarch 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
spa-GCaMP6m
Plasmid#67557Purposephotoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6m
TagsHIS-tagExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV Cag Flex H2B Gcamp6f reverse
Plasmid#74155PurposeCalcium SensorDepositorInsertGcamp6f
UseAAVTagsH2BPromoterCAGAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synp-F-H2B-GCaMP6f
Plasmid#102994PurposeExpresses histone fused GCaMP6f under the synapsin promoterDepositorInsertH2B-GCaMP6f
UseAAVExpressionMammalianPromoterhuman synapsin I promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
VV209: sdChR(C138S E154A)-TS-GCaMP6f-ER in fck
Plasmid#58524PurposeExpresses sdChR(C138S E154A) fused to GCaMP6f in mammalian cellsDepositorInsertsdChR(C138S, E154A)-TS-GCaMP6f-ER
UseLentiviralTagsGCaMP6fExpressionMammalianMutationchanged Cysteine 138 to Serine; changed Glutamate…Promotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKL12-GCaMP6f-pHuji bb118
Plasmid#158981PurposeConstitutive expression (sigma 70 promoter) of GCaMP6f tethered to pHuji fluorophores in E. coli.DepositorInsertGCaMP6f-pHuji
ExpressionBacterialMutationcodon optimized for e. coli from Addgene#100833 a…PromoterBba_J23118 (sigma 70)Available SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCHpr-GCaMP6f
Plasmid#221039PurposeExpresses GCaMP6f under the rat pro-melanin-concentrating hormone promoterDepositorInsertGCaMP6f
UseAAV; Rat targetingExpressionMammalianMutationA317EPromoterRat MCHAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD5-GCaMP6f
Plasmid#178728PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GCaMP6f
Plasmid#178730PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
VV247: sdChR(C138S)-TS-GCaMP6f-ER in fck
Plasmid#58522PurposeExpresses sdChR(C138S) fused to GCaMP6f in mammalian cellsDepositorInsertsdChR(C138S)-TS-GCaMP6f-ER
UseLentiviralTagsGCaMP6fExpressionMammalianMutationchanged Cysteine 138 to SerinePromotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
VV246: CoChR(C108S)-GCaMP6f-ER in fck
Plasmid#58521PurposeExpresses CoChR(C108S) fused to GCaMP6f in mammalian cellsDepositorInsertCoChR(C108S)-GCaMP6f-ER
UseLentiviralTagsGCaMP6fExpressionMammalianMutationchanged Cysteine 108 to SerinePromotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP6f-P2A-Vmn1r78
Plasmid#133413PurposeFluorescent calcium reporter and mouse vomeronasal 1 receptor 78DepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP6f-P2A-Vmn1r237
Plasmid#133417PurposeFluorescent calcium reporter and mouse vomeronasal 1 receptor 237DepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSET-triple mutation-pa-GCaMP6f
Plasmid#67570Purposebacterial expression of a photoactivatable fluorescent calcium reporterDepositorInsertpa-GCaMP6f
TagsHIS-tagExpressionBacterialMutationV115H, L64F, T65SPromoterT7Available SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
sspa-GCaMP6m
Plasmid#67560Purposeshort photoactivatable fluorescent calcium reporterDepositorInsertsspa-GCaMP6m
ExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FAS-GCaMP6f-WPRE
Plasmid#216277PurposeAAV vector with hSynapsin promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in neurons that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman synapsin 1 (hSyn)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOS008E: Entry vector for: GCaMP6F calcium sensor (cytosolic)
Plasmid#163064PurposeEntry vector for: GCaMP6F calcium sensor (cytosolic)DepositorInsertGCaMP6F
UseGateway CloningAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKK1 -pFlp-18::mito4x-GCaMP6f
Plasmid#194969PurposeFluorescent reporter of mitochondrial matrix Ca2+.DepositorInsert4 repeats of Cox8 presequence plus GCaMP6f
ExpressionWormPromoterFlp-18Available SinceJune 21, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAS1 - pRig-3::GCaMP6f::unc-54
Plasmid#194970PurposeFluorescent reporter of cytosolic calcium in C.elegans.DepositorInsertGCaMP6f
ExpressionWormPromoterrig-3Available SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP6f-P2A-Vmn1r86
Plasmid#133415PurposeFluorescent calcium reporter and mouse vomeronasal 1 receptor 86DepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GCaMP6f
Plasmid#209931PurposeCre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter. Based on construct from Pouchelon et al Cell Rep Methods. 2022.DepositorInsertGCaMP6f
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromoterhSynAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD4-GCaMP6f
Plasmid#178727PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD6-GCaMP6f
Plasmid#178729PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GCaMP6f
Plasmid#178731PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-GCaMP6f
Plasmid#178732PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGCaMP6f
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-CFL-SN-P2A-GCaMP6f
Plasmid#181742PurposeAAV vector for expressing CFL-SN and GCaMP6fDepositorInsertCFL-SN-P2A-GCaMP6f
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TetO(3G)-GCaMP6f-WPRE
Plasmid#186205PurposeExpress GCaMP6f under TetO(3G)DepositorInsertGCaMP6f
UseAAVTags6xHis (N terminal on insert), T7 epitope, and Xpr…PromoterTetO(3G)Available SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP6f-P2A-Vmn1r85
Plasmid#133414PurposeFluorescent calcium reporter and mouse vomeronasal 1 receptor 85DepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-IRES2-rat-Letm1
Plasmid#212661PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and rat-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6m-p2A-ChRmine-ST
Plasmid#227787PurposeCation channelrhodopsin ChRmine targeted to the neuronal soma and proximal dendrites in a viral vectorDepositorInsertDIO-GCaMP6m-p2A-ChRmine-ST
UseAAVExpressionMammalianAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-IRES2-MCS
Plasmid#212660PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and a multiple cloning site (MCS) after an IRES sequenceDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-Drosophila-Letm1
Plasmid#212663PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and Drosophila-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-GCaMP6f-4x128-mAGNET
Plasmid#166023PurposeExpresses GCaMP6f in CaMKII+ cells with low miRNA-128 expressionDepositorInsertGCaMP6f with 4 miR-128 binding sites
UseAAV and Mouse TargetingTagsNoneExpressionMammalianAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α-loxP-GCaMP6f-loxP-WPRE
Plasmid#233288PurposeAAV vector with EF1α promoter and Cre-Out GCaMP6f, enabling to express GCaMP6f in Cre-negative cells.DepositorInsertGCaMP6f
UseAAVPromoterEF1αAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x- GCaMP6f-IRES2-rat-Letm1-ΔEFhand
Plasmid#212662PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and rat-Letm1 with mutations in its EF-handDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEY12
Plasmid#191018PurposeFluorescent reporter driving panneuronal nuclear GCaMP6s expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s-T78H
Plasmid#100021PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference LSSmOrange nested within the reporting superfolder cpGFP-T78HDepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFP and T78H m…PromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEY13
Plasmid#191019PurposeFluorescent reporter driving amphid and phasmid nuclear GCaMP6s expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s
Plasmid#100020PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference Large Stokes Shift (LSS) mOrange nested within the reporting superfolder cpGFP.DepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFPPromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only