We narrowed to 34,176 results for: cel=
-
Plasmid#89174Purposeencodes human/murine miR-146a and ZsGreen1DepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pSKA397
Plasmid#80380Purposemini-Tn7 delivery plasmid with metE under the cpcG2Δ59 promoter.DepositorInsertscat
metE
UseSynthetic Biology; Mini-tn7 delivery vectorExpressionBacterialPromotercat promoter and cpcG2Δ59Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTE4495
Plasmid#80338Purposemammalian expression MbCpf1 nuclease and Mb crRNADepositorInsertsMb crRNA
MbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO HA-AMPKa2 AS
Plasmid#69827PurposeExpresses AMPK alpha 1 in mammalian cells in a doxycycline inducible mannerDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-2 (PRKAA2 Human)
UseLentiviralTagsHAExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-HA-NEMO
Plasmid#27560DepositorAvailable SinceAug. 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGL2 p15 4xSBR2 Mut 3' box
Plasmid#15708DepositorInsertp15 4xSBR2 (CDKN2B Human)
UseLuciferaseExpressionMammalianMutationMutant 3' box. The 3' box contains the …Available SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
2xMARS
Plasmid#205233PurposeExpresses two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-iin mammalian cellsDepositorInserttwo repeats of PLEKHA5 aa 143-271 with K163A and R164A mutations (PLEKHA5 Human)
TagsNuclear Export Sequence and mScarlet-iExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKI_ΩBBMVP16&WUS
Plasmid#220348PurposeExpresses BBM-VP16 and WUS in plant cellsDepositorTagsVP16 transcriptional activation domainExpressionPlantPromoterCaMV 35S and RPS5AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGGD_MiniTurboID-YFP
Plasmid#222434PurposeGolden Gate / Green Gate module for adding MiniTurboID and YFP as C-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGGB_YFP-MiniTurboID
Plasmid#222433PurposeGolden Gate / Green Gate module for adding YFP and MiniTurboID as N-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti UBC hNLRP3-mNG
Plasmid#218642PurposeExpresses NLRP3 tagged with mNeonGreen in mammalian cells (lentiviral); driven by the weak UBC promoter with puro selectionDepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pELPS-eDHFR-YFP-T2A-Renilla
Plasmid#193253PurposeTriple reporter plasmid in pELPS with eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferaseDepositorInsertThe eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
UseLentiviralTagsRenilla luciferase (rLuc) and yellow fluorescent …MutationNonePromoterEF1aAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mNG-CAAX
Plasmid#183870PurposeRepair template for the stable expression of a mNeonGreen-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mNeonGreen-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmNeonGreen-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-BlastR [M1G]
Plasmid#171805PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_ISG15
Plasmid#99322PurposeLuciferase validation vector with ISG15 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr1: 947976 -949995 (ISG15 Human)
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2-P14P5K
Plasmid#79570Purposeexpression of mCherry-tagged CRY2PHR fused to iSH2 domain of mouse Pip5k1cDepositorInsertPip5k1c (Pip5k1c Mouse)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationR445E and R446E; truncation of amino acids 636-66…PromoterCMVAvailable SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2NS-IRES-dOrai-IRES-mCherry
Plasmid#72896PurposeMammalian expression of dmBACCS2NS, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2NS-IRES-dOrai-IRES-mCherry
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
GAMA-bio
Plasmid#47747PurposeExpresses enzymatically monobiotinylated full-length GAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised GAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1 3xHA-MKK7a1-EE
Plasmid#47578PurposeBacterial expression plasmid for GST-3xHA-tagged constitutively active MKK7a1DepositorInsertMKK7a1-EE (Map2k7 Mouse)
Tags3xHA and GSTExpressionBacterialMutationResidues 73-420 of RefSeq sequence. Ser271 to Gl…Available SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only