We narrowed to 13,645 results for: sequence
-
Plasmid#47792PurposeExpresses enzymatically monobiotinylated full-length EBL1 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised EBL1
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 C64Y
Plasmid#139326PurposePlasmid expressing a sgRNA to introduce BRCA1 C64Y using base editingDepositorInsertsgRNA to insert BRCA1 C64Y using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
TMED3-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170996PurposeHiLITR transcription factor with full-length TMED3 targeting sequence (ER/Golgi)DepositorInsertTMED3(FL)-NNES-hLOV-TEVcs(ENLYFQ/M)-GAL4bd-VP64-V5 (TMED3 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight Q175
Plasmid#53566PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-Q175
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 FS10
Plasmid#113956Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, S212N substitution…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-PHLDA3(wt)
Plasmid#72557PurposeHypoxia induced mutant PHLDA3. Contains the HRE from VEGF sequence (5 repeats) upstream of PHLDA3.DepositorAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
FR_HNF4A2-C106R
Plasmid#31123DepositorInsertHNF4A (HNF4A Human)
TagsMycExpressionMammalianMutationsplice variant 2, mutation C106R. Wild type seq…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhAC T2A tDimer
Plasmid#101722Purpose- humanized - variant of pAAV hSyn YFP-CaRhAC Addgene # 101721– less reliable in hippocampal neuronsDepositorInsertsCatRhAC
red fluorescent protein
UseAAVMutationE497K,C569DPromoterhuman Synapsin1 promotor and ribosomal skip seque…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Linked Free NES
Plasmid#182485PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free PcPTS
Plasmid#182486PurposeYeast integrative plasmid for expressing fusion protein ERG20-PcPTS, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertFPPS-PTS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-AS9 (Mito MTS)-Delta N67-mMCL1
Plasmid#45822DepositorInsertAS9(Mito MTS)-Delta N67-mMCL1
ExpressionMammalianMutationATP Synthase subunit 9 is used as a Mito Targetin…Available SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-LAP-KNL1-M3
Plasmid#115896PurposeUsed for expression of siRNA-resistant KNL1-M3 (modified codons 258 and 259) from the FRT site of FlpIn cells upon addition of doxycyclin.DepositorInsertKNL1-M3 (KNL1 Human)
TagsEYFPExpressionMammalianMutationFragment of KNL1 containing three KNL1 repeat seq…Available SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONRG_P4-P1R:MUM4_0.3Pro_35S
Plasmid#128558PurposeGateway (Invitrogen) promoter clone (pDONRG_P4-P1R) containing a 307 bp MUM4 (At1g53500) promoter fragment fused to the 54 bp 35S minimal promoter sequence, for use in Three-way Gateway cloningDepositorTypeEmpty backboneUseGateway promoter entry clonePromoterMUM4 core promoter with 35S enhancerAvailable SinceSept. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-V1251R_R
Plasmid#147376PurposeMammalian Expression of HsNot1iso1-V1251RDepositorInsertHsNot1iso1-V1251R (CNOT1 Human)
ExpressionMammalianMutationA deletion of 5 AA 822-827 SKMKPS-> T and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRK5-H1-shRNA-CMV-HA-PACSIN1
Plasmid#72577PurposeBicistronic construct expressing PACSIN1 shRNA and HA-PACSIN1-rescue constructDepositorInsertsUseRNAiTagsHAExpressionMammalianMutation5 silent mutations around shRNA recognition seque…PromoterCMV and H1Available SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-MRPP3-His
Plasmid#67866Purposebacterial expression of PRORP (KIAA0391), full coding sequence (mitoch. form) + C-term. His tagDepositorInsertMRPP3 (KIAA0391 Human)
TagsHisExpressionBacterialMutationAmino acid 46 of recombinant MRPP3 is preceded by…PromoterT7Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-AP-His
Plasmid#72049PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only