We narrowed to 14,068 results for: crispr grnas
-
Plasmid#121041PurposeMoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.DepositorInsertUCT-part guide RNA (Stanley Qi sequence)
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
dead Sa Cas9
Plasmid#138162PurposeFor orthogonal R loop assay (use with Sp-derived base editor, Sp gRNA, and Sa gRNA for assay)DepositorInsertdSaCas9
TagsNLSExpressionMammalianMutationD10A + N580APromoterCMVAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE391
Plasmid#149281PurposeT-DNA encoding TRV2 with FT augmented gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA_FT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE392
Plasmid#149282PurposeT-DNA encoding TRV2 with mFT augmented gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA_mFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1.530
Plasmid#205441PurposeLevel 1 Position 1 pUC19 vector with sgRNA and GmR. Used for homologous recombination with Cas12a editing vector pC1.509. sgRNA targets pC1.509 for removal.DepositorInsertRepB gRNA
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEE390
Plasmid#149280PurposeT-DNA encoding TRV2 with gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE387
Plasmid#149285PurposeT-DNA encoding TRV2 with FT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1_FT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE386
Plasmid#149284PurposeT-DNA encoding TRV2 with gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE388
Plasmid#149286PurposeT-DNA encoding TRV2 with mFT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1_mFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFE-Puro
Plasmid#170069PurposeExpresses S. pyogenes CRISPR chimeric RNA element (with F+E modifications) with customizable gRNA from U6 promoter and puromycin resistance from EFS-NS promoterDepositorInsertCas9 guide RNA scaffold with the F+E scaffold modification
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-SpCas9-NG
Plasmid#117919PurposeExpresses 3xFLAG-NLS-SpCas9-NG-NLS in mammalian cells.DepositorInsertSpCas9-NG (L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B Human, Synthetic, S. pyogenes)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoterAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SaCas9
Plasmid#102853PurposeA single-chain light-controllable dSaCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (GRIN2B Human, Synthetic, S. aureus)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoter;Available SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only