We narrowed to 23,935 results for: crispr
-
Plasmid#107382PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Target-AID (pRZ762)
Plasmid#131300PurposeCAG promoter expression plasmid for NLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-pmCDA1(R187W with reference to NCBI ABO15149.1)-NLS-UGI-P2A-EGFP.DepositorInsertNLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-pmCDA1(R187W with reference to NCBI ABO15149.1)-NLS-UGI-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(NT)-PGKpuro2ABFP-W
Plasmid#163169PurposeLentiviral plasmid with non-targeting gRNA, co-expression of BFP tagDepositorInsertNon-targeting
UseCRISPR and LentiviralTagsBFPExpressionMammalianPromoterU6Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
AA028
Plasmid#216008PurposeFragmid fragment: (Cas protein) nickase Cas for base editingDepositorHas ServiceCloning Grade DNAInsertnCas9 (D10A)_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
Cas12j-8-puro
Plasmid#194966PurposeThe plasmid expresses human codon-optimized Cas12j-8 and puromycin resistence gene.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA1-NLS(sv40) (BPK5050)
Plasmid#115136PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AA304
Plasmid#216072PurposeFragmid fragment: (guide cassette) guide expressionDepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v1; trRNA_v1 [Sa]; terminator_v1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7556 pHR (hU6-crCD46-EFS-PuroR-WPRE)
Plasmid#214880PurposeLentiviral vector encoding RfxCas13d targeting CD46 guideDepositorInserthU6-crCD46-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRDA_936
Plasmid#216094PurposeCas12a [EnAs] knockout targeting CD46, CD47, CD55, CD81, positive controlDepositorInsertCD46, CD47, CD55, CD81 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -0
Plasmid#180010PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTE4497
Plasmid#80339Purposemammalian expression FnCpf1 nuclease and Fn crRNADepositorInsertsFn crRNA
FnCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only