We narrowed to 46,692 results for: cha;
-
Plasmid#119090PurposeBacterial expression of human phox homology (PX) domain, SNX9-PX (246-376)DepositorAvailabilityAcademic Institutions and Nonprofits only
-
PI3KC2gamma-PX (1200-1310)
Plasmid#119121PurposeBacterial expression of human phox homology (PX) domain, PI3KC2gamma-PX (1200-1310)DepositorAvailabilityAcademic Institutions and Nonprofits only -
pFSW Doc2beta 6X mutant
Plasmid#128816PurposeTo make virus expressing Doc2beta 6X mutantDepositorInsertDoc2beta (Doc2b Rat)
UseLentiviralTagsIRES-EGFPMutationD163A, D218A, D220N, D303A, D357A, D359APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-eGFP-2xStrep-IRES-Puro
Plasmid#141395PurposeLentiviral expression of SARS-CoV-2 protein; transient expression and generate lentivirusDepositorInserteGFP
UseLentiviralTags2xStrepExpressionMammalianMutationhuman codon optimizedPromoterEF1alphaAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCbs FlagOmomyc
Plasmid#113168PurposeExpression of FLAG tagged Omomyc in mammalian cellsDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKC117_pLenti_TetOff_MVP_IRES_PABPC1_INT
Plasmid#242113PurposeTet- or Dox-repressible expression of MVP and PABPC1 fused to INT (human PARP4 fragment)DepositorUseLentiviralMutationPABPC1 aa 1-370, PARP4 aa 1562-1724PromoterTRE3GAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP V107M
Plasmid#114180PurposeORAI1 channel with C-terminal YFP, carrying the mutation V107M in the protein 1st transmembrane domain, responsible for a constitutive activity and associated with tubular aggregate myopathy (TAM).DepositorAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
PC1575
Plasmid#232088PurposeMammalian expression plasmid for ubiquibody (uAb) cloning backbone. Includes an Esp3I restriction site directly upstream of GSGSG linker and CHIPΔTPR CDS and a C-terminal IRES-mCherry cassette.DepositorInsertuAb with cloning Esp3I restriction site
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG eGFP NLS
Plasmid#170830PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locusDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALENTagsNLSExpressionMammalianPromoterCAGAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 GfaABC1D hM4D mCherry SV40
Plasmid#92286PurposeAAV DREADD expressionDepositorAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1 hSCN5A
Plasmid#145374Purposeexpresses human Nav1.5 (WT) in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ
Plasmid#64875Purposelentiviral expression of human POLQDepositorAvailable SinceAug. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-mCherry-p2A-full length LIC1
Plasmid#74601Purposeexpresses LIC1 in mammalian cells; untagged but cells indicate expression with diffuse mCherryDepositorInsertfull length human dynein light intermediate chain 1 (DYNC1LI1 Human)
UseLentiviralExpressionMammalianPromoterSFFVAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FullLength-TET1-WT(21)
Plasmid#124396PurposeFull-length TET1 used to PiggyBAC rescue the function of TET1/2 DKO cellsDepositorInsertFLAG-FullLength-TET1 (TET1 Human)
TagsFlagExpressionMammalianMutationfull length protein is 2136 aaAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpRYc-ABE8e-EGFP
Plasmid#208340PurposeExpresses SpRYc-ABE8e in mammalian cellsDepositorInsertecTadA(8e)-nSpRYc
UseCRISPRExpressionMammalianMutationSc++ (1-1119), SpRY (1111-1368), D10APromoterCMVAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 IP3R3 WT
Plasmid#236453Purposetransient overexpression of IP3R3 in mammalian cellsDepositorInsertIP3R3 (Itpr3 Rat)
ExpressionMammalianAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-HSV TK-P2A-H2-Kb SCT-T2A-mCD47-E2A-mCD55-F2A-neo-AAVS1
Plasmid#205446Purposehuman AAVS1-targeting plasmid for expression of HSV TK, H2-Kb SCT, mouse CD47, and mouse CD55DepositorInsertHSV TK-H2-Kb SCT-mCD47-mCD55
ExpressionMammalianPromoterEF1aAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDY32 AAVS1-PuroR-9xTet0-minCMV-IGKleader-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA
Plasmid#161928PurposeDonor plasmid for integrating minCMV promoter-driven dual surface marker/fluorescent reporter at AAVS1 locusDepositorInsertSurface marker and Citrine activation reporter
UseSynthetic BiologyExpressionMammalianPromoterpEFAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-ER WT
Plasmid#49498PurposeExpresses HA-tagged ER wild-type in mammalian cellsDepositorAvailable SinceDec. 12, 2013AvailabilityAcademic Institutions and Nonprofits only