We narrowed to 14,262 results for: Cas9
-
Plasmid#84365PurposeCas9-gRNA plasmid for mouse Cbfa2t2 KnockoutDepositorInsertCbfa2t2-gRNA2
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
TU#1805_CRISPR_unc-73_exon2
Plasmid#82359Purposeto create unc-73B null alleleDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRDA_052
Plasmid#136474PurposeLentiviral expression of AsCas12a gRNADepositorInsertPuromycin resistance
UseLentiviral and Synthetic BiologyPromoterEF1aAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJ204-loxP-EF1a-mCherry-NeoR-lox2272-BGHpA-siteA-HDR
Plasmid#154826PurposeLanding pad for Cre/lox-based recombinase-mediated cassette exchange (RMCE) in CHO cells, donor plasmid for CRISPR/Cas9-mediated targeted integration in CHO cells (site A)DepositorInsertsmCherry
NeoR
ZsGreen1-DR
UseCRISPR and Cre/LoxTagsPESTExpressionMammalianPromoterCMV, EF1a, and SV40 early promoterAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon5
Plasmid#217456PurposeFor TP53 knockout targeting exon 5 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti NG-ABE8e_P2A_GFP + PuroR
Plasmid#242000PurposeLentiviral plasmid for generation of cell lines stably expressing NG-ABE8e base editor. NG-ABE8e expression can be followed by GFP fluorescence. Contains PGK-puromycin resistance cassette.DepositorInsertNG-ABE8e
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pG3H-PE3max-attR1R2
Plasmid#213049PurposeDestination vector Expressing nCas9 and RT fusion protein and carrying Gateway recombination sitesDepositorInsertsCas9 nickase
M-MLV Reverse Transcriptase
UseNote: this plasmid needs helper pvs1-vir2 for rep…ExpressionPlantMutationH840A, R240K, N413K,Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ATG5
Plasmid#99573PurposeExpresses Cas9 with sgRNA targeting Exon 7 of ATG5DepositorAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC EJ7-GFP
Plasmid#113617PurposeReporter for canonical-NHEJ. Reporter for end joining between two double-strand breaks, induced with the 7a and 7b sgRNAs with CAS9. EJ between the distal ends w/o indel mutations restores GFPDepositorInsertEJ7-GFP variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJ204-loxP-EF1a-tagBFP-HygR-lox2272-BGHpA-siteT9-HDR
Plasmid#154827PurposeLanding pad for Cre/lox-based recombinase-mediated cassette exchange (RMCE) in CHO cells, donor plasmid for CRISPR/Cas9-mediated targeted integration in CHO cells (site T9)DepositorInsertsTagBFP
HygR
ZsGreen1-DR
UseCRISPR and Cre/LoxTagsPESTExpressionMammalianPromoterCMV, EF1a, and SV40 early promoterAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE347
Plasmid#153228PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AC 4-μHOM
Plasmid#113619PurposeReporter for Alt-EJ, variant of EJ7-GFP. Double strand breaks are induced with the 7a & 7h, or 7a & 7i sgRNAs, with CAS9. EJ using 4 nt of microhomology causes a deletion mutation and restores GFPDepositorInsert4-μHOM variant of EGFP
ExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE4396
Plasmid#74041PurposeExpresses human codon-optimized AsCpf1 and As crRNA.DepositorInsertsAs crRNA
AsCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre stuffer v3
Plasmid#158030Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA casette (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
px459-TDP-43 sgRNA1
Plasmid#133762PurposeExpresses Cas9 and human TDP-43 sgRNADepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-1- LentiCRISPRv2
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2 control
Plasmid#217443PurposeLentiviral vector expressing Cas9 without a targeting sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only