We narrowed to 11,847 results for: NSI
-
Plasmid#236431Purposetransient overexpression of E2F1 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1-hSTING (S366A)
Plasmid#214155PurposeTransient expression of STINGDepositorAvailable SinceMarch 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Luc-PS9
Plasmid#177942PurposeTransient mammalian expression of Luc2 (firefly luciferase) along with SARS-CoV-2 sequence 20080-21171 (PS9) within the 3'UTR. Resulting transcript is packaged into SARS-CoV-2 virus-like particles.DepositorInsertLuc2 (ORF1ab )
ExpressionMammalianAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-Pink1
Plasmid#101874PurposeTransient expression of Pink1-YFP in mammalian cellsDepositorInsertPTEN induced putative kinase 1 (PINK1 Human)
Tagsfluorescent tag EYFPExpressionMammalianPromoterCMVAvailable SinceOct. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1c-C1
Plasmid#131821PurposeExpresses HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is the cytoplasmic mutant causing AML, where…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).iGlucoSnFR2.mIRFP670nano3
Plasmid#244072PurposeCytosolic expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsmIRFP670nano3Available SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Luc-T20
Plasmid#177941PurposeTransient mammalian expression of Luc2 (firefly luciferase) along with SARS-CoV-2 sequence 20080-22222 (T20) within the 3'UTR. Resulting transcript is packaged into SARS-CoV-2 virus-like particles.DepositorInsertLuc2 (ORF1ab )
ExpressionMammalianAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKS037 - pCAGGS-3XFLAG-Smc3-mKate2-bpA
Plasmid#156447PurposeFor transient expression of mouse SMC3 tagged with mKate2DepositorAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE-2
Plasmid#72677PurposeExpresses Lambda Red recombinases and a dominant negative MutL allele all controlled by temperature sensitve cI857 repressor for high precision and efficiency MAGE experiments. Ap resistance marker.DepositorInsertmutL E32K
TagsnoneExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterpL promoterAvailable SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (5B)
Plasmid#85498PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the Mj 3NY (5B) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32H H70C D158S I159A L162RPromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSF-MjCouRS
Plasmid#229066PurposetRNA synthetase/tRNA pair for the in vivo incorporation of (7-hydroxy-4-coumarin-yl) ethylglycine (Hco), into proteins in E. coli in response to the amber (TAG) codonDepositorInsertMethanococcus jannaschii tRNA synthetase
ExpressionBacterialPromoterT7Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-CBE-Cas9n-Act3.0
Plasmid#178955PurposeIt consists of a Cas9 nickase (D10A) fused with a cytidine deaminase (A3A/Y130F) and MS2-SunTag-activators (ScFv-sfGFP-2xTAD), enabling simultaneous C to T conversion and gene activation.DepositorInserthA3A-zCas9-UGI-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL005-SOX2-sgRNA
Plasmid#175553PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus.DepositorInsertspCas9-nuclease and sgRNA against mouse SOX2 STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLM1110_LEU2
Plasmid#168460PurposeBig-IN Payload yeast assembly vector. Encodes LEU2 yeast selectable marker and components for bacterial copy number induction. Contains a mammalian transient (backbone) GFP-T2A-BSD selection cassette.DepositorInsertmRFP1
UseSynthetic Biology; Yeast assembly vector for big-…Available SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL007-NANOG-sgRNA
Plasmid#175555PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus.DepositorInsertspCas9-nuclease and sgRNA against mouse NANOG STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-2strep-FBH1
Plasmid#236464Purposetransient overexpression of FBH1 in mammalian cellsDepositorInsertFBH1 (FBXO18 Human)
ExpressionMammalianAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-CBE-SpRYn-Act3.0
Plasmid#178958PurposeIt consists of a SpRY nickase (D10A) fused with a cytidine deaminase (A3A/Y130F) and MS2 -SunTag-activators (ScFv-sfGFP-2xTAD), enabling simultaneous C to T conversion and gene activation.DepositorInserthA3A-SpRY-UGI-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-NLS-R-GECO
Plasmid#32462PurposeMammalian expression of nucleus-targeting red fluorescent genetically encoded Ca2+ indicator for optical imagingDepositorInsertR-GECO1.0
TagsNLS sequence DPKKKRKVExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-NPM1c
Plasmid#131813PurposeExpresses Flag-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsFLAGExpressionMammalianMutationThis is the cytoplasmic mutant causing AML, where…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only