174,374 results
-
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
RRL.sin.cPPT.SFFV/Ace2.IRES-puro.WPRE (MT126)
Plasmid#145839PurposeLentiviral vector genome to ectopically express human Ace2DepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
SaKKH-ABE8e
Plasmid#138502PurposeA-to-G base editorDepositorInsertecTadA(8e)-nSaCas9 (KKH)
ExpressionMammalianAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
SpyTag003-MBP
Plasmid#133450PurposeExpresses SpyTag003-MBP (maltose binding protein) in bacterial cytoplasmDepositorInsertSpyTag003-MBP
TagsHis6 and Thrombin cleavage siteExpressionBacterialMutationPeptide tag added to N-terminus of MBP via a GSGE…PromoterT7Available SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
STING-V1
Plasmid#124262PurposeC-terminally tagged STING with split Venus Construct for studying localisation of STING in different cellular compartmentsDepositorAvailable SinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACYC-Taq
Plasmid#102793PurposeExpresses Taq DNA polymerase under WT T7 promoterDepositorInsertTaq DNA polymerase
ExpressionBacterialAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER dCas9-TET1CD
Plasmid#101921PurposeThe dCas9-TET1CD fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948).DepositorInsertdCas9-TET1CD
UseLentiviralExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-mTurquoise2
Plasmid#98828PurposeIn vivo visualization of lysosomes (can be used for colocalization studies)DepositorInsertLamp1
TagsmTurquoise2ExpressionMammalianPromoterCMVAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSFV-Helper1
Plasmid#92073PurposeThis is a plasmid for transcription of defective helper RNA, providing structural Semliki forest virus (SFV) proteins to package recombinant SFV genomes into virus like particles.DepositorInsertcDNA of SFV genome with deletion removing the nonstructural SFV proteins and also the viral RNA packaging signal.
UseHelper plasmid, for run-off transcription and rna…Available SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only