We narrowed to 23,393 results for: ESC
-
Plasmid#135448PurposeHuman expression vector containing Ubiquitous Chromatin Opening Element (UCOE) upstream of EF1alpha promoter, dCas9 that is fused to NLS, tagBFP and a KRAB domain.DepositorInsertdCas9-BFP-KRAB
UseLentiviralTagstagBFPExpressionMammalianPromoterEF1AAvailable SinceJuly 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-NLuc1.1_12GLI-FLuc_CBF-GLuc
Plasmid#113862PurposeTriple pathway reporter, 3P-Luc; wnt-NLuc1.1, hedgehog-FLuc, notch-GLuc; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-NLuc1.1
12GLI-Fluc
CBF-GLuc
UseLentiviralExpressionMammalianAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-iRFP_PTCH1-mTurquoise2_CBF-tdTomato
Plasmid#113865PurposeTriple pathway reporter, 3P-Fluor; wnt-iRFP, hedgehog-mTurquoise2, notch-tdTomato; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-iRFP
PTCH1-mTurquoise2
CBF-tdTomato
UseLentiviralExpressionMammalianAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-sfCherry11x4-ß-actin
Plasmid#70220PurposeExpresses sfCherry11x4-ß-actin in mammalian cellsDepositorAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
aMHC-puro rex-neo
Plasmid#21230DepositorInsertalpha myosin heavy chain promoter
UseLentiviralAvailable SinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)-mNeonGreen
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB120
Plasmid#167150PurposeMoClo-compatible Level 1 (position 1) vector encoding Kanamycin resistance cassette, for expression in plantsDepositorInsertpNOS-nptII-ocsT
ExpressionPlantPromoterpNOSAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHtrA-TEV-His12
Plasmid#137036Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi HtrA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66500.2 (BB_0104 Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
eMscL WT
Plasmid#107454PurposeeMscL WT is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motifDepositorInsertbacterial mechanosensitive ion channel of large conductance (mscL Escherichia Coli)
UseAdeno-associated viralTagsKir2.1 ER export signal (FCYENEV) and tdTomato fl…ExpressionMammalianPromoterhuman synapsin 1Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-sfCherry11-ß-actin
Plasmid#70221PurposeExpresses sfCherry11-ß-actin in mammalian cellsDepositorAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pELPS-eDHFR-YFP-T2A-Renilla
Plasmid#193253PurposeTriple reporter plasmid in pELPS with eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferaseDepositorInsertThe eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
UseLentiviralTagsRenilla luciferase (rLuc) and yellow fluorescent …MutationNonePromoterEF1aAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_sfCherry2(11)_Clathrin light chain
Plasmid#83032PurposeExpresses sfCherry2(11) tagged clathrin light chain in mammalian cellsDepositorAvailable SinceJune 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
GANES-DEVD-BNLS
Plasmid#50842PurposeExpresses a tandem green ddFP heterodimer in mammalian cells, construct 1 for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid RANLS.DepositorInsertddGFP A and ddGFP B
TagsNES sequence LALKLAGLDIGS placed after ddGFP A an…ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
NESRA-DEVD-BNLS
Plasmid#50849PurposeExpresses a tandem red ddFP heterodimer in mammalian cells, construct 1 for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid GANLS.DepositorInsertddRFP A and ddRFP B
TagsNES sequence LQKKLEELELDE placed after ddGFP A an…ExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
RANLS-DEVD-BNES
Plasmid#50840PurposeExpresses a tandem ddFP heterodimer in mammalian cells, plasmid 1 for a translocation-based red fluorescent caspase-3 biosensor, used together with plasmid 2 (BNLS).DepositorInsertddRFP A and ddRFP B
TagsNES sequence LALKLAGLDIGS and triplicated NLS seq…ExpressionMammalianPromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYTRW22K_7Ti1
Plasmid#177293Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
aMHC-Puro Rex-Blast
Plasmid#21231DepositorInsertalpha myosin heavy chain promoter
UseLentiviralAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDipA-TEV-His12
Plasmid#137042Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi DipA with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66790.1 (BB_0418 Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length protein, contains signal p…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBBA57-TEV-His12
Plasmid#137033Purposeexpression clone from T7 promoter for full-length (signal peptide containing) B. burgdorferi BBA57 with C-terminal TEV-protease-cleavable His12DepositorInsertAAC66270.1 (BB_A57 Borrelia burgdorferi B31)
TagsHis12 (TEV protease cleavable)ExpressionBacterialMutationwild type, full-length BBA57, contains signal pep…PromoterT7Available SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only