171,035 results
-
Plasmid#207847PurposeBLaTM-System; Antiparallel negativecontrol EmrE_TMD4_3P_G90V_G97V in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P
Plasmid#207846PurposeBLaTM-System; Antiparallel positive control EmrE_TMD4_3P in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF752
Plasmid#88486PurposeDonor Vector containing ZNF752 transcription factor, part of the Human TFome CollectionDepositorInsertZNF752 (ZFP3 Human)
UseGateway donor vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDZ114
Plasmid#159357PurposeExpresses sfYFP tagged with ssrA from the Pcin promoterDepositorInsertsfYFP
UseSynthetic BiologyPromoterPcinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-HaloSFPQY527A
Plasmid#166949PurposeLentiviral plasmid expressing Halo-tagged SFPQ Y527A protein from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG G-CEPIA1er
Plasmid#105012PurposeER calcium sensorDepositorInsertG-CEPIA1er
ExpressionMammalianPromoterpCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 TadCBEd
Plasmid#193845PurposeExpress TadCBEd (with SaCas9) in mammalian cellsDepositorInsertTadCBEd with SaCas9
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-OMP25
Plasmid#141150PurposeFluorescent labeling of the outer mitochondrial membrane (OMM) in mammalian cellsDepositorInsertOMP25 (Synj2bp Rat)
TagsAcGFPExpressionMammalianMutationOMP25 c terminus from addgene plasmid #69598PromoterCMVAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-IRG1-HA
Plasmid#198181PurposeMammalian expression of HA-tagged human ACOD1 (IRG1)DepositorInsertACOD1 (ACOD1 Human)
TagsHAExpressionMammalianMutationHA tag is added to C-terminal of target proteinPromoterCMVAvailable SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
PIK3CA - Exon20 H1047R
Plasmid#16639DepositorAvailable SinceMarch 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCVL Traffic Light Reporter 1.1 (Sce target) Ef1a BFP
Plasmid#31481DepositorInsertTraffic Light Reporter 1.1 (Sce target) EF BFP
UseLentiviralMutationmCherry contains M9S and M16L to reduce backgroun…Available SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ2A
Plasmid#65373PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
R777-E285 Hs.ROCK2
Plasmid#70569PurposeGateway ORF clone of human ROCK2 [NM_004850.3] with stop codon (for native or N-terminal fusions)DepositorInsertROCK2 (ROCK2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-gfap(Intron1/5'/Exon1-zebrafish)
Plasmid#39761DepositorAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS300
Plasmid#22846PurposeBackbone for expressing plant artificial miRNAsDepositorAvailable SinceJan. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
FLT3-MSCV-IRES-GFP
Plasmid#184778PurposeExpresses wildtype FLT3 in mammalian cellsDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only