We narrowed to 22,957 results for: TES
-
Plasmid#64214PurposemCherry fused between Cry2 and PGK-1 to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pPICZ-aC-KHC-BZ
Plasmid#160427PurposeExpression of c-luciferase from sp. Kornikeria hastingsi carriebowae (Belize)DepositorInsertluciferase
UseLuciferaseTags6x Histidine tag, Yeast alpha secretion factor, c…ExpressionYeastPromoterAOXAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
A*01:03:01
Plasmid#203293PurposeOverexpress HLA alleleDepositorInsertA*01:03:01 (HLA-A Human)
ExpressionMammalianAvailable SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-Ku70siR-Mut6E
Plasmid#46962PurposeFor constitutive or doxycycline-inducible expression of mutant human Ku70 unable to bind DNA and resistant to siRNA. Confers resistance to puro. Use T-REx cells for doxycycline-inducible expression.DepositorInsertKu70 (XRCC6 Human)
TagsGFP-FLAGExpressionMammalianMutationMut6E corresponding to K282E K287E T300E K331E K3…PromoterCMV TetAvailable SinceAug. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
PGEX-6P1-hNF2-AR mutant
Plasmid#107149Purposebacterial expressionDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-1: shALAS-1
Plasmid#22750DepositorAvailable SinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 dC2
Plasmid#68831PurposeExpresses c-myc-tagged human RAD18 deleting Polymerase eta binding domainDepositorInsertc-myc tagged human RAD18 deleting Polymerase eta binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pShuttle-EGFP-CLASP2 340-1084
Plasmid#24383DepositorInsertCLASP2 (340-1084) (CLASP2 Human)
UseAdenoviralTagsEGFPExpressionMammalianMutationCLASP2 deletion mutant that retains MT lattice bi…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTOPO-MCL1S159A
Plasmid#21606DepositorInsertMCL-1 S159A (MCL1 Human)
ExpressionMammalianMutationSerine 159 mutated to Alanine, abolishing phosph…Available SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer7
Plasmid#138579PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17918617_17920400DepositorAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer6
Plasmid#138578PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17898458_17899478DepositorAvailable SinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer3
Plasmid#138575PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17848003_17849903DepositorAvailable SinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer2
Plasmid#138574PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17843052_17844983DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4-Cluster Promoter Delta 1
Plasmid#100126PurposeIt contains ~1.4Kb of the miR-183/96-182 cluster promoterDepositorInsertmiR-183-96-82 Cluster promoter (MIR182 Human)
UseLuciferaseAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETM33_CEP55_EABR
Plasmid#178469PurposeBacterial expression of human domain with His-tag and GST tagDepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Myc-TRFcT
Plasmid#44573DepositorUseRetroviralTagsMycExpressionMammalianMutationTRF2 where TRFH domain (aa42-241) has been replac…Available SinceMay 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mqgDUX4
Plasmid#21176DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pX330 NC-FKBP-Cas9
Plasmid#162725PurposeMammalian expressionDepositorInsertFKBP F36V
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceJan. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
AfrLEA3m_mCh-2xFKBP (pBS1137)
Plasmid#185321PurposeFor the mammalian expression of the brine shrimp protein AfrLEA3m attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertAfrLEA3m
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only