We narrowed to 9,360 results for: CAG
-
Plasmid#120868PurposePiggybac transposon plasmid for live animal optical imagingDepositorInsertpcDNA3-Antares2
ExpressionMammalianMutationAntares2 ampliconPromoterCAG PromoterAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPH-T2A-GFP-shP53
Plasmid#102895PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPH-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAT024
Plasmid#171636PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting BFP and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-BFP
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB
Plasmid#236763PurposeA piggybac-based cloning vector containing mouse U6 promoter-driven sgRNA for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB
Plasmid#236764PurposeA piggybac-based cloning vector containing dual sgRNAs for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, human U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-PYL-DNMT1-NEO)
Plasmid#114396PurposeFor PYL-DNMT1 expressionDepositorInsertPYL-DNMT1
ExpressionMammalianPromoterCMVAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330a dCas9-LSD1
Plasmid#92362PurposeModified CAG promoter-containing vector for ubiquitous expression of catalytically inactive Cas9 fused to LSD1. For targeted enhancer demethylation in chicken embryos.DepositorInsertdCas9-LSD1
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAIP-hXRCC1pd-eGFP
Plasmid#206033PurposeMammalian expression of PAR-deficient hXRCC1pd coupled to eGFP under the control of a CAG promoterDepositorInserthXRCC1
TagseGFPExpressionMammalianMutationS103A,R186A,S184A,S193A,S219A,S220A,S236A,S268APromoterCAGAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DRS-1 sgRNA / hSpCas9
Plasmid#172841PurposeMammalian expression of the DRS-1 synthetic sgRNA sequence under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertDRS-1 sgRNA under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_TUBA1B sgRNA / hSpCas9
Plasmid#172834PurposeMammalian expression of a sgRNA targeting the intron 1 of TUBA1B (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of TUBA1B under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSSA-RPG
Plasmid#85932PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-SSA. Puro-T2A-EGFP
UseDual-reporter surrogateExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
p55-H2B-Dendra2
Plasmid#80609PurposeEncodes H2B-Dendra2-fusion protein under the CAG promoter. Linearize using Asc1 and Not1 for mouse embryo injection.DepositorAvailable SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNHEJ-RPG
Plasmid#85931PurposeConstitutively express DsRed and conditionally express Puro and EGFP. Used to test transfection efficiency and enrich genetically modified cellsDepositorInsertpPB-CMV-DsRed-polyA-CAG-NHEJ. Puro-T2A-EGFP
UseDual-reporter surrogateExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPPH-T2A-GFP-shP53
Plasmid#102897PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core-p65-HSF1 followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPPH-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VPP300-T2A-GFP-shP53
Plasmid#102896PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-VP192-P300core followed by T2A-GFP as a reporter. Includes p53 shRNA expression cassette.DepositorInsertdCas9VPP300-T2A-GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_Tuba1b sgRNA / hSpCas9
Plasmid#172835PurposeMammalian expression of a sgRNA targeting the intron 1 of Tuba1b (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Tuba1b under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAB-HDAC5(mut-H-Y)
Plasmid#114398PurposeFor PYL-HDAC5 H1006Y expressionDepositorInsertPYL-HDAC5 H1006Y
ExpressionMammalianMutationadditional D593E compared to NCBI ref NP_005465.2PromoterCMVAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-PYL-HDAC5-NEO)
Plasmid#114395PurposeFor PYL-HDAC5 expressionDepositorInsertPYL-HDAC5
Tags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared with NCBI reference NP_005465.2PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-HDAC5(mut-H-A)
Plasmid#114397PurposeFor PYL-HDAC5 H1006A expressionDepositorInsertPYL-HDAC5 H1006A
Tags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared to NCBI ref NP_005465.2PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-EXPR(PYL-cat_dom_HDAC5)
Plasmid#114401PurposeFor PYL-HDAC5 catalytic domain expressionDepositorInsertPYL-HDAC5 catalytic domain
Tags3xFlag-NLS (internal)ExpressionMammalianMutationS220F and the deletion of M221PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAB-EXPR(PYL-Nterm_dom_HDAC5)
Plasmid#114402PurposeFor PYL-HDAC5 N terminal domain expressionDepositorInsertPYL-HDAC5 N terminal domain
Tags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared to NCBI ref NP_005465.2PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_GFP
Plasmid#134843PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A EGFPExpressionMammalianPromoterCAGAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_mCherry
Plasmid#134844PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A mCherryExpressionMammalianPromoterCAGAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_Puro
Plasmid#134845PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A PuromycinExpressionMammalianPromoterCAGAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
mouse b8 full length
Plasmid#217817PurposeFull length mouse integrin b8 expressionDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse a5 full length
Plasmid#217810PurposeFull length mouse integrin a5 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse b6 full length
Plasmid#217816PurposeFull length mouse integrin b6 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mouse av full length
Plasmid#217809PurposeFull length mouse integrin av expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRT043-CLYBL-DDdcas9-VPH
Plasmid#158091PurposeInducible expression of dCas9-VPH from the CLYBL locus for CRISPR activationDepositorInsertCLYBL-CAG-DDdCas9VPH-T2A-GFP
UseTALENExpressionMammalianPromoterCAGAvailable SinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRT029
Plasmid#127969Purposedouble-DHFR-degron controlled expression of dCas9-BFP-KRAB from the CLYBL locusDepositorInsertCLYBL-CAG-DHFR-dCas9-BFP-KRAB-DHFR
UseTALENExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMTL5
Plasmid#127967PurposeDHFR-degron controlled expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorInsertAAVS1-CAG-DHFR-KRAB-dCas9-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMTL3
Plasmid#127966Purposeconstitutive expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorInsertAAVS1-CAG-KRAB-dCas9-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceNov. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
mouse b3 full length
Plasmid#217814PurposeFull length mouse integrin b3 expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
mouse a2b full length
Plasmid#217812PurposeFull length mouse integrin a2b expressionDepositorAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 Nlgn2
Plasmid#59358PurposeLentiviral expression vector: Neuroligin 2 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
R26TV LSL-TRL
Plasmid#68476PurposeRosa26 targeting vector expressing Cre-dependent tTR-KRAB-rtTA3-Luc cassetteDepositorInserttTR-KRAB-2A-rtTA3-2A-Luciferase
UseCre/Lox, Luciferase, and Mouse TargetingExpressionMammalianPromoterCAGAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
human a5 full length
Plasmid#217818PurposeFull length human integrin a5 expressionDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBK.014
Plasmid#187215PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 6 [CAG-CTG]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 6 [CAG-CTG])
Cas1 + Cas2
UseSynthetic BiologyExpressionBacterialPromoterT7/LacAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_rActb sgRNA / hSpCas9
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBK.011
Plasmid#187211PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 3 [CTG-CAG]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 3 [CTG-CAG])
Cas1 + Cas2
UseSynthetic BiologyExpressionBacterialPromoterT7/LacAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-e1 sgRNA / hSpCas9
Plasmid#172830PurposeMammalian expression of a sgRNA targeting the exon 2 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the exon 2 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only