We narrowed to 7,798 results for: aav
-
Plasmid#105679PurposeExpresses a soma-targeted GtACR1 in mammalian neurons under the CaMKIIa promoterDepositorInsertstGtACR1
UseAAVTagsFusionRed and Kv2.1ExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-MCP-huADARE488QT490A
Plasmid#159922PurposeFusion of MS2 coat protein to Human ADAR2 E488QT490A, under Ef1a promoter, with WPRE. AKA 116v5DepositorAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn1-DIO-Flpo
Plasmid#237222PurposeFor Cre-dependent expression of Flp recombinaseDepositorInsertFlpo recombinase
UseAAV and Cre/LoxExpressionMammalianPromoterhSynAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-EGFP
Plasmid#153163PurposeMouse gamma-synuclein (mSncg) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianPromotermSncgAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-mCherry
Plasmid#50462PurposeDouble floxed mCherry under the control of EF1a promoterDepositorInsertmCherry
UseAAVTagsN/APromoterEF1aAvailable SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO EYFP
Plasmid#27056DepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, and AAV9InsertEYFP
UseAAVExpressionMammalianAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Chronos-tdTomato
Plasmid#62726PurposeAAV-mediated expression of Chronos-tdTomato under the Syn promoter. Using bGHpA signal. tdTomato has codons varied between the first and second tandem repeats to reduce recombination.DepositorHas ServiceAAV8InsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-GCaMP6s
Plasmid#105714PurposeCan be used to express GCaMP6s in the presence of Flp recombinase. Can be used to create adeno-associated virus to express Flp-dependent GCaMP6s.DepositorHas ServiceAAV8InsertGCaMP6s
UseAAV; Flp/frtExpressionMammalianPromoterEf1a, Human elongation factor-1 alphaAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ADP-MCS-FLAG
Plasmid#192360PurposeAdipocyte-specific overexpression of genesDepositorTypeEmpty backboneUseAAVTags3xflagExpressionMammalianPromoteradiponectin promoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-GRAB_g5-HT3.0
Plasmid#208727PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0 in astrocytesDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0
UseAAVPromoterGfaABC1DAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iATPSnFR2.A95A.A119L.HaloTag
Plasmid#209661PurposeExpression of iATPSnFR2, low affinityDepositorInsertiATPSnFR2.A95A.A119L.HaloTag
UseAAVMutationA95A.A119LPromoterGFAPAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Mito-HyPerGRt
Plasmid#173198PurposeAAV transfer plasmid for a HyPer7 and tdTomato fusion under hSyn promoterDepositorInsertHyper7-tdTomato
UseAAVPromoterhSynAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-MA4-GFP
Plasmid#114380PurposeDoxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC407 - pAAV EF1a eGFP
Plasmid#60058PurposeAn AAV packaging vector that expresses enhanced green fluorescent protein under control of the EF1a promoter.DepositorInsertenhanced Green Fluorescent Protein
UseAAVExpressionMammalianPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ASAP4b-Kv-WPRE
Plasmid#201030PurposeExpresses somatically enriched ASAP4b in neurons, can be used to package AAVDepositorInsertASAP4b-Kv
UseAAVAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-42:AAVS1-mTagRFPT-CAAX
Plasmid#107580PurposeHomology arms, promoter and linker-mTagRFPT-CAAX sequence for internal insertion of CAGGS-driven mTagRFPT-CAAX at the AAVS1 safe harbor location in human cellsDepositorInsertAAVS1 Homology Arms with CAGGS-driven mTagRFPT-CAAX (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-sCAG-eGFP-ACAP1
Plasmid#203800PurposeAAV vector plasmid expressing human ACAP1 fused to eGFP under a short variant of the CAG (sCAG) promoterDepositorAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iATPSnFR2.S29W.A95K.HaloTag
Plasmid#209659PurposeExpression of iATPSnFR2, high affinityDepositorInsertiATPSnFR2.S29W.HaloTag
UseAAVMutationS29W.A95KPromoterGFAPAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL5069 (pDonor(AAVS1),CRISPR_Pse)
Plasmid#200904PurposeEncodes a mini-transposon derived from Pseudoalteromonas Tn7016 with a splice acceptor-T2A-PuroR-T2A-eGFP cargo, and a CRISPR RNA under a U6 promoter. Total transposon size = 2,024 bp.DepositorInsertMini Tn7016 (AAVS1 NGS), PseCRISPR (tSL425)
ExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
paavCAG-pre-mGRASP-mCerulean
Plasmid#34910PurposepreDepositorHas ServiceAAV5Insertpresynaptic mGRASP
UseAAVPromoterCAGAvailable SinceNov. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_g5-HT3.0
Plasmid#208717PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0 in neuronsDepositorHas ServiceAAV8InsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0
UseAAVPromoterhSynAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Blast
Plasmid#227267PurposeEmpty AAVS1 targeting donor for the insertion of Blast and a strong EF1a promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Chronos-GFP
Plasmid#58805PurposeAAV expression of Chronos-GFP under the CaMKII promoterDepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV2/9 REP-AAP-ΔCAP
Plasmid#205991PurposeRep and AAP protein expression for AAV CREATE librariesDepositorInsertAAV9 Rep and AAP proteins for CREATE libraries
UseAAVAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CBA-DO(FAS)-GCaMP6s
Plasmid#110135PurposeCre-off expression of GCaMP6sDepositorInsertGCaMP6s
UseAAV and Cre/LoxExpressionMammalianAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_5-HT1.0
Plasmid#140552PurposeExpresses the 5-HT sensor GRAB_5-HT1.0 in neuronsDepositorHas ServiceAAV9Insert5-HT sensor GRAB_5-HT1.0
UseAAVPromoterhSynAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry
Plasmid#135634PurposeAAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertChR2-mCherry
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Puro-CAG-mNG2(1-10)
Plasmid#206042PurposeRepair template for the integration of a mNG2(1-10) expression cassette into the AAVS1 locus in human cells.DepositorInsertAAVS1 homology arms with SA-P2A-Puro marker and CAG-mNG2(1-10) expression cassette
UseCRISPR and Synthetic Biology; Donor templateExpressionMammalianAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-dSaCas9-NLS-VPR
Plasmid#68495PurposeAAV vector containing nuclease null SaCas9 fused to VPRDepositorInsertdSaCas9
UseAAVTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only