We narrowed to 1,462 results for: U6 promoter
-
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Tetra Loop-8A8G
Plasmid#157982PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Tetra-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_MTH17CL396
Plasmid#136656PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:MTH17CL396 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:MTH17CL396 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_TH1477
Plasmid#136655PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:TH1477 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:TH1477 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMG18311
Plasmid#136653PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:LMG18311 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD9:LMG18311 chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W
Plasmid#67974PurposeCRISPR gRNA expression vector with an improved scaffold and puro/BFP markersDepositorInsertU6gRNA cassette, PGKpuro2ABFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W
Plasmid#67977PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mCherry markersDepositorInsertU6gRNA cassette, PGKpuro2AmCherry cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKBFP2AGFP-W
Plasmid#67979PurposeCas9 activity reporter (control) with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmAG-W
Plasmid#67976PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mAG markersDepositorInsertU6gRNA cassette, PGKpuro2AmAG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W
Plasmid#67975PurposeCRISPR gRNA expression vector with an improved scaffold and puro/ZsG markersDepositorInsertU6gRNA cassette, PGKpuro2AZsG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PL6-CS-WR
Plasmid#122512Purposeconstruction for sgRNA transcription with Plasmodium falciparum U6 promotorDepositorTypeEmpty backboneUseCRISPRPromoterPfU6Available SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBA950
Plasmid#122239PurposeCROP-seq vector optimized for sgRNA expression and CRISPRi activity. This vector expresses a eGFP-NT2 sgRNA with modified U6 promotor and sgRNA constant region.DepositorInsertBFP selectable marker, plus a modified mU6 promoter and sgRNA constant region for optimized CRISPRi activity
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE N-terminal
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only