We narrowed to 2,390 results for: control GFP
-
Plasmid#66841Purposeexpression of near-infrared PI(4,5)P2 biosensorDepositorInsertPH-PLCdelta1
TagsiRFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNLS-LEXY (pDN138)
Plasmid#72657Purposegolden gate entry vector for mCherry-LEXY tagging of proteins (N-terminal cMyc(P1A) NLS)DepositorTypeEmpty backboneUseGolden gate entry vectorTagsNLS and mCherry-LEXYExpressionMammalianPromoterCMV-FAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMM0494
Plasmid#128981PurposeLEU2 preassembled entry vectorDepositorInsertLEU2 5' homology-ConLS-sfGFP dropout-ConR1-LEU2 3' homology
ExpressionYeastAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKvenus-Scribble
Plasmid#58738PurposeExpresses Venus-tagged human Scribble proteinDepositorAvailable SinceSept. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pInducer21 Flag-Sesn3
Plasmid#61866PurposeDox inducible lentivirial expression of Flag-Sesn3 (mouse)DepositorAvailable SinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTE5425
Plasmid#229032PurposeExpression vector for 10xHis-phi29 DNA polymerase (catalytically inactive mutant D249E): PT7-lacO-g10leader-p2 dead-T7 terminator, CamRDepositorInsertPT7-lacO-g10lead-10xHisTag-phi29 DNAP (D249E, catalytically inactive)
Tags10x His-tag + Factor Xa recognition siteExpressionBacterialPromoterPT7-lacO and T7 promoterAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-104
Plasmid#79842PurposeExpresses NLS-PpsR2-VP16 under CMV promoterDepositorInsertNLS-PpsR2-VP16
TagsNuclear localization signal of nuclear cap-bindin…ExpressionMammalianMutationRpPpsR2 cysteine 439 changed to serinePromoterCMVAvailable SinceAug. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
CRISPRmTmG2
Plasmid#69992PurposeThe CRISPR construct targets near the LoxP sites in Rosa-pCA-loxP-mTdtomato-loxP-mEGFP mice.DepositorInsertgRNA that targets near LoxP sites
Available SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-NOG(AtUBI10)-MTAP-LUC
Plasmid#234371PurposeT-DNA vector for expression of the the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAs, no gRNA included (NOG)DepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis Ubi10 and MTAP1 (synthetic)Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
KBB364
Plasmid#185083PurposeRFA1 fused to GFP under control of GAL1 promoterDepositorInsertRFA1
TagsGFPExpressionYeastPromoterGAL1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEN_TGmiR_Luc-A
Plasmid#25765PurposeEntry vector withTRE promoter driving control Luciferase miR30-based shRNA with GFP coexpression.DepositorInsertLuciferase miR-shRNA
UseEntry vectorTagsGFPAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
miR-144 Trap
Plasmid#60934Purposeto knockdown endogenous miR144 levels; lentiviral vector containing 8x copies of complementary miR-144-binding sites cloned 3' to GFP under the control of a biPGK promoterDepositorInsertmiR-144 Trap
UseLentiviralTagsGFPPromoterbidirectional phosphoglycerate kinase promoter (b…Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:ATG-3xHA-S11
Plasmid#108238PurposeBinary vectors used for the inducible expression of tripartite split-sfGFP components (3xHA-S11 as control) in plantsDepositorInsertATG-3xHA-S11
UseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
miR-451 Trap
Plasmid#61487Purposeto knockdown endogenous miR144 levels; lentiviral vector containing 8x copies of bulged trap sequences cloned 3' to GFP under the control of a biPGK promoterDepositorInsertmiR-451 Trap
UseLentiviralTagsGFPExpressionMammalianPromoterbidirectional phosphoglycerate kinase promoter (b…Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
GWF243
Plasmid#133608PurposeNS3a-CAAX-(IRES)-EGFP-DNCR2-TIAM-P2a-BFP-GNCR1-LARGDepositorInsertNS3a-CAAX, EGFP-DNCR2-TIAM, BFP-GNCR1-LARG
ExpressionMammalianAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
HIVGKO
Plasmid#112234PurposeHIVGKO contains a codon-switched eGFP under the control of the HIV-1 specific promoter, and mKO2 under the control of the constitutive promoter EF1aDepositorInsertcsGFP-EF1a-mKO2
UseLentiviralAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Split PS Intein TetR-vp16
Plasmid#242023PurposeBlue-light-induced reconstitution of the tTA transactivator via split PS Intein-mediated fusion of TetR and vp16.DepositorInsertSplit PS Intein TetR-vp16
ExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FluoSTEP-AKAR
Plasmid#181844PurposeGenetically encoded FRET-based sensor for monitoring PKA activity near a protein of interest. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-AKAR
TagsmRuby2 and sfGFP(1-10)ExpressionMammalianPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYpet-C1
Plasmid#22780DepositorInsertYpet
ExpressionMammalianMutationControl for intermolecular Rac1 biosensor FRET. S…Available SinceDec. 18, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCyPet-C1
Plasmid#22779DepositorInsertCyPet
ExpressionMammalianMutationControl for intermolecular Rac1 biosensor FRET. S…Available SinceDec. 18, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMM0617
Plasmid#128993PurposeloxP-KIURA3-loxP preassembled entry vectorDepositorInsertKanR-ColE1 URA 5' homology-ConLS'-sfGFP dropout-ConRE'-loxP-KIURA3-loxP-URA3 5' homology
ExpressionYeastAvailable SinceOct. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
XLone-BSD SARS-CoV2 N P2A mCherry
Plasmid#154398PurposePiggybacTransposon-based tunable and temporal expression control of SARS-CoV2 N and mCherryDepositorInsertSARS-CoV2 N Protein (N SARS-CoV2)
UsePiggybacTagsmCherryExpressionMammalianPromoterTRE3GAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
ptagBFP-LacI
Plasmid#103839PurposeFlourescent marker for lacO arraysDepositorInserttagBFP-LacI
ExpressionMammalianMutationLacI: C19T (silent, L7L), T264C (silent, A88A), C…PromoterSV2Available SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ptagBFP-LacI-NLS-VP16
Plasmid#103837PurposeTranscription activator (transactivation domain of viral VP16 protein) that is constitutively recruited lacO arraysDepositorInserttagBFP-LacI-NLS-VP16
ExpressionMammalianPromoterSV2Available SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCKtheoRaj12m
Plasmid#69943PurposepSTC2,TheoHHAzRaj12mut,cisRaj12-sfGFP, kanRDepositorInsertpSCKtheoRaj12m
UseSynthetic Biology; Psc101 origin of replicationAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgNeg1
Plasmid#166998PurposeLentiviral expression of negative control sgRNA for CRISPRi knockdownDepositorInsertNegative control sgRNA 1
UseCRISPR and LentiviralPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgNeg2
Plasmid#166999PurposeLentiviral expression of negative control sgRNA for CRISPRi knockdownDepositorInsertNegative control sgRNA 2
UseCRISPR and LentiviralPromoterU6Available SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only