We narrowed to 2,448 results for: ara-2
-
Plasmid#46009DepositorInsertECK120010783 Terminator
UseSynthetic BiologyExpressionBacterialPromoterPBADAvailable SinceJune 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-hTRF2
Plasmid#103803PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhTRF2: deletion of amino acids 1-42 and 476 compa…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/FFT-LL5BIP
Plasmid#112830Purposetransient/stable overexpressionDepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_KanR_BastaR_Rb7_GFP
Plasmid#186427Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar) with fluorescent marker (eGFP)DepositorInsertsKanR
BastaR
Rb7
eGFP
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a-C9ORF80
Plasmid#128418PurposeExpress C9ORF80 in E. coli with a His tag (C-terminal)DepositorAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-FAM86A
Plasmid#85117Purposebacterial expression of FAM86ADepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-neo
Plasmid#166467PurposeEmpty vector to express overexpression cDNADepositorTypeEmpty backboneUseLentiviralAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3omega1_KanR_BastaR
Plasmid#186426Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar)DepositorInsertsKanR
BastaR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
p3A9cbetaTCR.HSV2.3
Plasmid#69594PurposeTCR beta chain genomic transgenic construct for generation of gBT-I miceDepositorInsertTCR beta VJ region from clone HSV2.3 (Tcrb Mouse)
ExpressionMammalianAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFP.R265
Plasmid#138167PurposeExpresses the split mCherry reporter interrupted by the SspDnaB M86 artificially mini-intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMECP2-GFP
Plasmid#181904PurposeFluorescently tagged MECP2, GFPDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGC-Lb12-P1Bb
Plasmid#231387PurposeFor crRNA cloning with LbCas12a vectors for genome editing in ArabidopsisDepositorInsertU6-29
UseCRISPRExpressionPlantAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-ER-mRFP
Plasmid#231180PurposeExpresses control plasmid for ER-mitochondrial linkers, tagged with mRFP, from a lentiviral vectorDepositorInsertER-mRFP
UseLentiviralPromoterCMVAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-20nmEML-mRFP
Plasmid#231181PurposeExpresses a synthetic linker, tagged with mRFP, stabilizing the ER-mitochondrial distance at 20 nm from a lentiviral vectorDepositorInsert20nmEML-mRFP
UseLentiviralPromoterCMVAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRM56 tet-AR(1-707)C617Y
Plasmid#183504PurposeLentiviral vector expressing a doxycycline-inducible truncated DNA-binding mutant androgen receptor (AR mutant C617Y)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralExpressionMammalianMutationTruncated mutant AR; spans AR 1-707 aa, and conta…PromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET51b-His-TEV-CLIP-tag
Plasmid#167274PurposeOverexpression of CLIP-tag in E. coliDepositorInsertCLIP-tag
TagsHis x10ExpressionBacterialPromoterT7Available SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET51b-His-TEV-SNAP-tag_fast
Plasmid#167271PurposeOverexpression of the fast variant (E30R) of SNAP-tag in E. coliDepositorInsertSNAPf-tag
TagsHis x10ExpressionBacterialMutationE30RPromoterT7Available SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-YAP shRNA2
Plasmid#166485PurposeHuman YAP RNAiDepositorInsertshRNA for human YAP (YAP1 Human)
UseLentiviralAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMTTH+mEGFP-LANA
Plasmid#157801PurposeExpression of mEGFP and LANA peptide fusion proteinDepositorInsertmEGFP-LANA
TagsHis6 and MBPExpressionBacterialPromoterpTACAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only