We narrowed to 4,416 results for: BRE
-
Plasmid#177514PurposeMammalian Expression Plasmid of anti-TRIP8b (constant) (Rat). Derived from hybridoma N212/7.DepositorInsertanti-TRIP8b (constant) (Rattus norvegicus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263E
Plasmid#141340PurposeLentiviral vector for expression of human NHEJ1-S263E in mammalian cellsDepositorInsertNHEJ1-S263E (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263EPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263A
Plasmid#141341PurposeLentiviral vector for expression of human NHEJ1-S263A in mammalian cellsDepositorInsertNHEJ1-S263A (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263APromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 mKO2 HuR.DelHNS IRES Puro
Plasmid#110389Purposeγ-Retroviral transfer vector for expressing HuR (delHNS), V5 and mKO2 tags, IRES-driven Puromycin selection.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseRetroviralTagsV5 and mKO2ExpressionMammalianMutationHNS (HuR nuclear-cytoplasmic shuttling sequence) …PromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b [N212/7R]
Plasmid#164154PurposeMammalian Expression Plasmid of anti-TRIP8b (Rat). Derived from hybridoma N212/7.DepositorInsertanti-TRIP8b (Rattus norvegicus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Iduna/RNF146 [N201/35R]
Plasmid#164157PurposeMammalian Expression Plasmid of anti-Iduna/RNF146 (Mouse). Derived from hybridoma N201/35.DepositorInsertanti-Iduna/RNF146 (Mus musculus) recombinant mouse monoclonal antibody (Rnf146 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-ZNF423 [N328B/37R]
Plasmid#140077PurposeMammalian Expression Plasmid of anti-ZNF423 (Human). Derived from hybridoma N328B/37.DepositorInsertanti-ZNF423 (Human) recombinant mouse monoclonal antibody (ZNF423 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRISM-Fuse-cmlc2-mRFP
Plasmid#117787PurposeDonor for precise CRISPR directed genomic integration using the GeneWeld methodDepositorInsertmRFP
UseSynthetic BiologyAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-REEP1/2 [N326D/29R]
Plasmid#114510PurposeMammalian Expression Plasmid of anti-REEP1/2 (Mouse). Derived from hybridoma N326D/29.DepositorInsertanti-REEP1/2 (Mus musculus) recombinant mouse monoclonal antibody (Reep1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-PARIS/ZNF746 [N196/16R]
Plasmid#114475PurposeMammalian Expression Plasmid of anti-PARIS/ZNF746 (Human). Derived from hybridoma N196/16.DepositorInsertanti-PARIS/ZNF746 (Homo sapiens) recombinant mouse monoclonal antibody (ZNF746 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sites
Plasmid#120295PurposeAAV Vector for expression of C-terminal SpyCas9 fragement with split-intein and a CMV-driven AcrIIA4 with two miR-122 binding sitesDepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Anti-Malin [N85/18.1R]
Plasmid#114513PurposeMammalian Expression Plasmid of anti-Malin (Human). Derived from hybridoma N85/18.1.DepositorInsertanti-Malin (Homo sapiens) recombinant mouse monoclonal antibody (NHLRC1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Stonin-2 [N346/9R]
Plasmid#114484PurposeMammalian Expression Plasmid of anti-Stonin-2 (Human). Derived from hybridoma N346/9.DepositorInsertanti-Stonin-2 (Homo sapiens) recombinant mouse monoclonal antibody (STON2 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-GFP-PGK-Puro
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-GFP-PGK-Puro
Plasmid#110863PurposeLentiviral vector for constitutive expression of Cas9-HF1-P2A-GFP (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
10xHis-ataxin-3 *SIM-HA
Plasmid#89983PurposeExpresses His- and HA-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
Tags10xHis and HAExpressionMammalianMutationmutated aa 162IFVV to 162AFAAAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *SIM
Plasmid#89979PurposeExpresses GFP-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2_3xflag_CHEK2
Plasmid#136526PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIKDepositorAvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 hygro
Plasmid#104995PurposeThis lentiviral construct delivers hSpCas9 and hygromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 neo
Plasmid#104996PurposeThis lentiviral construct delivers hSpCas9 and G418 resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA puro
Plasmid#104990PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and puromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA hygro
Plasmid#104991PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and hygromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
PARP1 FL
Plasmid#169815PurposeExpresses codon optimised full length His tagged PARP1 in bacterial cellsDepositorInsertPoly[ADP-ribose] polymerase 1 (PARP1 Codon optimised, Synthetic, Human)
TagsMKHHHHHHMKQExpressionBacterialMutationValine 762 mutated to an alaninePromoterT7 promoterAvailable SinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA blast
Plasmid#104993PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and blasticidin S resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-zSpG
Plasmid#179316PurposeIn vitro transcription of SpG-Cas9 mRNA zebrafish codon-optimized from T3 promoterDepositorInsertZebrafish codon-optimized Cas9 variant SpG
UseCRISPR; In vitro transcription by t3 promoterTagsSV40-NLSMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-zSpRY
Plasmid#179317PurposeIn vitro transcription of SpRY-Cas9 mRNA zebrafish codon-optimized from T3 promoterDepositorInsertZebrafish codon-optimized Cas9 variant SpRY
UseCRISPR; In vitro transcription by t3 promoterTagsSV40-NLSMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 puro
Plasmid#104994PurposeThis 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRM210 LGP (Luciferase GFP Puro)
Plasmid#174722PurposeExpresses the firefly luciferase gene, E2A, eGFP, F2A, and the puromycin resistance geneDepositorInsertsFirefly Luciferase
eGFP
pac
UseLentiviral and LuciferaseTagsE2A linker and F2A linkerExpressionMammalianPromoterMND, MND (off Luc-E2A), and MND (off Luc-E2A-eGFP…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Neo-Myr-Flag-DEST
Plasmid#15300Purposea Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORFDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralTagsFlag and MyrExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SCGB3A2 promoter-EGFP-EF1a-TagRFP
Plasmid#204821PurposeLentiviral vector for human SCGB3A2 promoter-driven expression of EGFPDepositorInsertAn upstream region including human SCGB3A2 promoter
UseLentiviralExpressionMammalianPromoterSCGB3A2 promoterAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro /BRAF-V600E
Plasmid#131724PurposeMammalian Expression of Flag tagged BRAFDepositorInsertBRAF (BRAF Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationV600EPromoterCMVAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv1.5 K+ channel [K7/45R]
Plasmid#140069PurposeMammalian Expression Plasmid of anti-Kv1.5 K+ channel (Rat). Derived from hybridoma K7/45.DepositorInsertanti-Kv1.5 K+ channel (Rat) recombinant mouse monoclonal antibody (Kcna5 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 blast
Plasmid#104997PurposeThis lentiviral construct delivers hSpCas9 and blasticidin S resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_mmIrf1 (closed)
Plasmid#160097PurposeExpresses murine Irf1 in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX_TRC311/NLS-Cas13d-P2A-Blast
Plasmid#212196PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-Blasticidin for RNA targeting. CasRx-2A-Blasticidin is driven by EF1a promoter. EGFP is driven by SV40DepositorInsertCasRx (NLS-RfxCas13d-NLS)-HA with 2A-Blasticidin
UseCRISPR and LentiviralTagsHA, NLS, and blasticidin S deaminaseExpressionMammalianPromoterEF-1α promoterAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pF CAG luc IRES neo
Plasmid#98294PurposeFor constitutive expression of firefly luciferase from the CAG promoter together with an IRES-linked neo resistance geneDepositorInsertsFirefly luciferase
IRES
Neomycin resistance gene (NeoR)
UseLentiviral and LuciferaseAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmIrf1
Plasmid#160098PurposeExpresses murine Irf1 in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-wtYAP
Plasmid#84009Purposeexpresses wtYAP in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro/RAF1
Plasmid#131725PurposeMammalian Expression of RAF1DepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGTag-NLS-eGFP-SV40
Plasmid#117811PurposeDonor for precise CRISPR directed genomic integration using the GeneWeld methodDepositorInserteGFP
UseSynthetic BiologyTagsNLSAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-xF2X-P2A-Puro
Plasmid#110873PurposeLentiviral vector for constitutive expression of xFNLS in mammalian cells (codon optimized)DepositorInsertxFNLS-2X(3.7)
UseLentiviralTags3X FLAGMutationD10A, A262T, R324L, S409I, E480K, E543D, M694I, E…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpG-His
Plasmid#179318PurposePlasmid for bacterial expression and purification of SpG-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpG
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGTag-TagRFP-CAAX-SV40
Plasmid#117809PurposeDonor for precise CRISPR directed genomic integration using the GeneWeld methodDepositorInsertTagRFP
UseSynthetic BiologyTagsCAAXAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD deltahexa
Plasmid#169714PurposeBacterial Expression of human hnRNPA1-A Low complexity domain including amino acids 186-320, hexapeptide including aa 259-264 deletedDepositorInserthnRNPA1 (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationhnRNPA1-A Low complexity domain including amino a…PromoterT7Available SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2 LRP6-APEX2-Ires-eGFP-PAC
Plasmid#180142Purposeused to biotinylate targets that are recruited near the receptor during Wnt signaling at different time periodsDepositorAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Pan-QKI [N147/6.1R]
Plasmid#114521PurposeMammalian Expression Plasmid of anti-Pan-QKI (Human). Derived from hybridoma N147/6.1.DepositorInsertanti-Pan-QKI (Homo sapiens) recombinant mouse monoclonal antibody (QKI Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mLPIN1
Plasmid#60803PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LPIN1 3' UTR and mutated miR-155 sitesDepositorInsertLPIN1 3'UTR and mutated miR-155 binding site (LPIN1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only