We narrowed to 4,851 results for: u6
-
Plasmid#126762PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-SpCas9-HF1 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than SpCas9HF1.DepositorInsertB-SpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; Q926A; amino acids 1005-1013…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO2
Plasmid#125518PurposeLentiviral backbone for cloning and expressing U6 driven sgRNAs with BsmBI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10704
Plasmid#183957PurposeU6-SKSKSO(crRNA array)-EF1a-PuroR-T2A-BFPDepositorInsertSKSKSO array
UseLentiviralTagsEF1a-Puro-T2A-TagBFPExpressionMammalianMutationPromoterU6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7
Plasmid#11795Purpose3rd generation lentiviral vector that expresses shRNA under the mouse U6 promoter. A CMV-EGFP reporter cassette is included in the vector to monitor expression.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromotermouse U6Available sinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSB700
Plasmid#64046PurposeLentiviral vector for expressing U6 sgRNA and CAGGS Cerulean fluorescent proteinDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterU6, CAGGSAvailable sinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMJ114
Plasmid#85995PurposeOne-guide Perturb-seq vector backbone; modified bovine U6 promoter; original constant regionDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermodified bovine U6-2Available sinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 sgRipk4 v3
Plasmid#158048Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Ripk4. NO Cas9DepositorInsertRipk4 sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-CreERT2 sgAdam10 v3
Plasmid#158047Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Adam10. NO Cas9DepositorInsertAdam10 sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
FUW-crRNA1and2-U6_TRE-dLbCpf1-NLS-hCTCF_WT-HA-P2A-tagBFP
Plasmid#194885PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-WT and crRNA-1 and -2 targeting the human MECP2 locus.DepositorInsertsdLbCpf1-NLS-hCTCF_WT
U6-crRNA1and2
UseLentiviralTagsHAExpressionMutationHuman codon optimized catalytically inactive LbCp…PromoterTRE and U6Available sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10871
Plasmid#183962PurposeU6-SKSKSO(crRNA array)-CAG-dCas12a(WT)-miniVPRDepositorInsertsdCas12a(wildtype)
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832APromoterCAG and U6Available sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsExpressionMammalianMutationPromoterTight TRE promoter and U6Available sinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ117
Plasmid#85997PurposeOne-guide Perturb-seq vector backbone; modified human U6 promoter; constant region 3DepositorInsertsEGFP-NT2_cr3
puro-T2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermodified human U6Available sinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-HF1-plus
Plasmid#126768PurposeExpression plasmid for human codon-opt. increased fidelity SpCas9-HF1-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMJ179
Plasmid#85996PurposeOne-guide Perturb-seq vector backbone; modified mouse U6 promoter; constant region 2DepositorInsertsEGFP-NT2_cr2
puro-T2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermodified mouse U6Available sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_Lb
Plasmid#155051PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterEF1a and U6Available sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRTagsExpressionBacterial and MammalianMutationPromoterU6Available sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only