We narrowed to 8,212 results for: chloramphenicol
-
Plasmid#114223PurposePOC12359, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type d-eDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_aFq
Plasmid#114224PurposePOC12362, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type a-qDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_bFq
Plasmid#114225PurposePOC12363, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type b-qDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_cFq
Plasmid#114226PurposePOC12364, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type c-qDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_dFq
Plasmid#114227PurposePOC12365, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type d-qDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_eFq
Plasmid#114228PurposePOC12366, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type e-qDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNatB (pACYCduet-naa20-naa25)
Plasmid#53613PurposeAllows expression of the fission yeast NatB complex - chloramphenicol markerDepositorAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCas9
Plasmid#167547PurposeUsed for CRISPR-Cas9 mediated recombineering in Enterococcus. Can clone desired gRNA using BsaI digestion.DepositorInsertschloramphenicol acetyl transferase
pUC19 origin of replication
UseCRISPRExpressionBacterialAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
p15A_SpyCas9_CmR
Plasmid#119162PurposeExpresses S. pyogenes Cas9DepositorInsertCas9 from S. pyogenes (NEWENTRY )
UseCrisprAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTuLys2CMR2
Plasmid#53544PurposeInhibition module. Constructed from the parent plasmids pLuxRI, pLuxmCherry, pET15bLCFPT7, and pLysS. The plasmid can express T7 lysozyme by inducing AHL and LuxR. Chloramphenicol resistanceDepositorInsertpLux
UseUnspecifiedAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMan operon
Plasmid#124888PurposeExpresses proteins encoding Man operon in E. faecalisDepositorInsertmanX1, manX2, manY, manZ, manO, EF0025
ExpressionBacterialAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGLU_66
Plasmid#225769PurposeThis is the native promoter from the catP chloramphenicol resistance cassette.DepositorInsertPcatP_[abr]
UseSynthetic BiologyMutationN/AAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIOM17
Plasmid#20870DepositorInsertaphA::cat
ExpressionBacterialAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJUMP39-1A(sfGFP)
Plasmid#126983PurposeLevel 1 vector with alternative selection marker (chloramphenicol). OriV 9 (pBBR322/ROP; medium copy number); sfGFP cloning reporter.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only