We narrowed to 15,997 results for: grn
-
Plasmid#100554PurposeExpresses AAVS1 sgRNA. Target sequence: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
p105_gRNA_Sa_CD40
Plasmid#213781PurposeExpresses CRISPRa gRNA for CD40 promoter and mScarlet. gRNA driven by mU6.DepositorInsertSa gRNA
UseCRISPR and LentiviralPromotermU6Available SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pegRNA_LMNA_CR-2-5
Plasmid#199275PurposepegRNA used to correct LMNA (c.1824C > T) mutationDepositorInsertLMNA 1824TtoC pegRNA
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_Luciferase_sgRNA
Plasmid#74190Purposelentiviral vector expressing sgRNA targeting LuciferaseDepositorInsertLuciferase sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nme2sgRNA_pLKO
Plasmid#119926PurposeNme2Cas9 U6-driven sgRNA cassetteDepositorInsertNmeCas9 sgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
EC2_4_dCas9_VPR_sgRNA
Plasmid#163709PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA_MS2_neo
Plasmid#118650PurposeTo clone sgRNA for activation dCas9DepositorTypeEmpty backboneUseLentiviralPromoterU6Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RACK1
Plasmid#127123DepositorInsertgRNA RACK1 (RACK1 Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
U6GRNA
Plasmid#68370PurposegRNA scaffold with hU6 promoterDepositorTypeEmpty backboneExpressionMammalianPromoterhU6Available SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available SinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
SpCas9_sgRNA_expression_in_pBluescript
Plasmid#122089PurposeU6 driven SpCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_AAVS1_sgRNA_2
Plasmid#155105Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting the AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_Dual_sgRNA
Plasmid#173202PurposeCoselection for PE3 or HDR in human cells. Vector for tandem expression of ATP1A1 G3 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
gRNAy
Plasmid#168294PurposeExpresses gRNA targeting the yellow gene in DrosophilaDepositorInsertU6.3-gRNA[y]-scaffold
ExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only