We narrowed to 8,284 results for: crispr grnas
-
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001147657)
Plasmid#76701Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001149518)
Plasmid#77529Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
SLBP non-targeting gRNA lambda phage
Plasmid#132548Purposeexpresses gRNA for SLBP-based CIRTSDepositorInsertgRNA SLBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149423)
Plasmid#80255Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148500)
Plasmid#80260Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.CYRANO
Plasmid#128755PurposeExpresses CYRANO gRNA for CRISPRiDepositorAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
U6-CjCas9-MS2gRNA-Backbone
Plasmid#210711PurposeThis plasmid express MS2 loop containing Cj Cas9 gRNADepositorInsertMS2 loop containing Cj Cas9 gRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
eGFP L138 gRNA
Plasmid#119133PurposegRNA that guides Cas9 and APOBEC complexes to L138 in eGFP.DepositorInserteGFP L138 gRNA
UseCRISPRMutationNonePromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-UGCG-KO
Plasmid#80010PurposegRNA to knock out expression of UGCG gene. The product of this gene catalyzes the first step in synthesis of glycosphingolipids.DepositorInsertUGCG (UGCG Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRainbow-DONOR1
Plasmid#75398PurposeCRISPRainbow-DONOR1DepositorInsertCm(R)-CcdB
UseCRISPRTagsnoPromoterBacteriaAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro Non-targeting sgRNA 1
Plasmid#109002PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertNon-targeting sgRNA #1
UseLentiviralExpressionMammalianPromotermU6 promoterAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_2
Plasmid#104049PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_1
Plasmid#104048PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_1
Plasmid#104050PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_1
Plasmid#86346PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only