We narrowed to 2,598 results for: pCas
-
Plasmid#204859PurposeFor cytosine base editing using miniSdd7 in monocotyledon plants (transient transformation)DepositorInsertminiSdd7-nSpCas9(D10A)-UGI
UseCRISPRExpressionPlantMutationD10A in SpCas9PromoterZmUbi-1Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330 EGFR-sgRNA
Plasmid#188633PurposeA human codon-optimized SpCas9 and chimeric guide RNA targeting C-terminus of human EGFRDepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable sinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS73
Plasmid#110629PurposeCRISPR/Cas9 vector for mutliplexed genome editing in Ustilago maydis. Expresses U. maydis codon-optimized Cas9 under the hsp70 promoter, contains a short version of U6 promoter, is self-replicatingDepositorInsertsshort U6 promoter
cas9
tnos terminator
UseCRISPR; Self-replicating in ustilago maydis, conf…TagsN-terminal NLS, C-terminal HA-tag +NLSExpressionBacterialMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU. maydis hsp70 promoter (Kronstad and Leong, 198…Available sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Td-CBEmax
Plasmid#196600PurposeMammalian expression of Td-CBEmaxDepositorInsertbpNLS-TadA-8e (N46L/E27R)-32aa linker-nSpCas9-bpNLS-P2A-UGI-bpNLS
Tags6*HisExpressionMammalianMutationTadA-8e (N46L/E27R); S. pyogenes Cas9 (D10A)Available sinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and tcp830Available sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAID6
Plasmid#136989PurposeYeast integration plasmid for expression of dLbCpf1-VP, dSpCas9-RD1152, SaCas9, and Csy4DepositorInsertsdLbCpf1-VP
dSpCas9-RD1152
SaCas9
Csy4
ExpressionYeastPromoterENO2, TDH3, TEF1, and TPI1Available sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable sinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWS3799-gRNA-Csy4-template
Plasmid#182827PurposeSpCas9 gRNA-Csy4 templateDepositorInsertSpCas9 gRNA scaffold + Csy4 sequence
UseCRISPRAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-2
Plasmid#86925PurposeTo express sgRNA target HUWE1 geneDepositorAvailable sinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
HUWE1-sgRNA-1
Plasmid#86924PurposeTo express sgRNA target HUWE1 geneDepositorAvailable sinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCCL-PGK-SPdCas9-BFP-DNMT3A(E752A)
Plasmid#71213PurposedCas9 fused to BFP and the human DNMT3A catalytically inactive domainDepositorInsertdSpCas9-BFP-DNMT3A(E752A), DNMT3A catalytic domain with inactivation mutation E752A
TagsdSpCas9-BFP-DNMT3A(E752A)ExpressionMammalianAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCC_01 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE
Plasmid#139086PurposeExpresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCSN061
Plasmid#101725PurposeSingle copy yeast plasmid expressing Cas9 from Streptococcus pyogenes (SpCas9), codon optimized for expression in Saccharomyces cerevisiae.DepositorInsertsS. pyogenes Cas9 codon optimized for expression in S. cerevisiae. (NEWENTRY )
KanMX marker expression cassette.
UseCRISPRTagsSV40 NLSExpressionYeastPromoterHeterologous TEF1 promoter from A. gossypii. and …Available sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAEL006511-Cas9
Plasmid#100580PurposeThe promoter of AAEL006511 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL006511-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL006511 and Opie2Available sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6GRNA
Plasmid#68370PurposegRNA scaffold with hU6 promoterDepositorTypeEmpty backboneExpressionMammalianPromoterhU6Available sinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_T7-PE2-Nuclease
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT57
Plasmid#223429PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKI1.1
Plasmid#85807PurposeCRISPR/Cas9 for Arabidopsis in pENTR/D-TOPODepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAG and NLSPromoterAtRPS5AAvailable sinceMay 18, 2017AvailabilityAcademic Institutions and Nonprofits only