We narrowed to 27,146 results for: RON
-
Plasmid#159885PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertintron GG3 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dox human Citron shRNA 1 GFP
Plasmid#155291PurposeLentivirus for doxycycline inducible expression of human Citron shRNA, GFP marker, based on Addgene 11652DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 GFP
Plasmid#155286PurposeLentiviral expression of human CIT shRNA, GFP expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Drosophila Nedd2-like caspase (DRONC)
Plasmid#157778PurposeE. coli expression vector pET23 with C-term 6xHis tagDepositorInsertDrosophila Nedd2-like caspase (DRONC) (Dronc Fly)
Tags6x HISExpressionBacterialPromoterT7Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated V2 O-Glycosylation site
Plasmid#120405Purposeenables eukaryotic expression of human plasma fibronectin in which the second O-glycosylation site was mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with a mutation…PromoterCMVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
B. thetaiotaomicron 16S toehold switch sensor
Plasmid#110697PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. thetaiotaomicron 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
A1-20B1(P004)
Plasmid#184056PurposeThis plasmid carries Yn situ preamplifier A1-20B1 sequence and is used for nickase based synthesis.DepositorInsertA1-20B1 preamplifier
UseSynthetic BiologyAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-mGFP-pA(AV222)
Plasmid#117858PurposeThis plasmid expresses membrane anchored GFP to facility axon morphology study.DepositorInsertmGFP
UseAdenoviralExpressionMammalianPromoterCMVAvailable SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
tetO-Bcl2-IRES-tdtomato(TET005)
Plasmid#117857PurposeThis plasmid expresses Bcl2 under the activation of tTA trans-activator along with fluorescent marker tdTomato.DepositorAvailable SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
A1-20B1 (P001)
Plasmid#161820PurposeThis plasmid carries Yn situ preamplifier A1-20B1 sequence.DepositorInsertA1-20B1
UseSynthetic BiologyAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-Kir2.1-pA-CMV-mRFP-pA(AV39)
Plasmid#117856PurposeThis plasmid expresses Kir2.1 along with fluorescent marker RFP under the control of CMV promoter. The vector also supports the construction of adenovirus using ADeasy system.DepositorAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
tetO-Fzd1-IRES-tdTomato (TET006)
Plasmid#160510PurposeThis plasmid expresses Fzd1 under the activation of tTA trans-activator along with fluorescent marker tdTomato.DepositorArticleInsertFzd1 (Fzd1 Mouse)
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-CAAX2 WPRE
Plasmid#236232PurposeAAV expression of a fluorescent marker, mScarletI, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmScarletI fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmScarletIPromoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCherry-pCAG-donor_opt(R2Tg)-GFP(intron)
Plasmid#223249PurposeMammalian expression of the optimized R2Tg RNA donorDepositorInsertR2Tg donor_opt
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Cry1)-DIO-intron336-Venus-NLS-D2
Plasmid#110055PurposeCry1 transcription fluorescence reporterDepositorInsertCry1 promoter and Venus (Cry1 Mouse)
UseAAV and Cre/LoxTagsNLS-D2ExpressionMammalianPromoterCry1Available SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T
Plasmid#227004PurposeAAV transfer plasmid encoding the human A53T mutant α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorInsertalpha synuclein A53T mutant (SNCA Synthetic, Human)
UseAAVMutationA53TPromoterCMVenh synapsinAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mTagBFP2-CAAX2 WPRE
Plasmid#236231PurposeAAV expression of a fluorescent marker, mTagBFP2, fused to the plasma membrane targeting sequence CAAX2DepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only