We narrowed to 7,853 results for: 11
-
Plasmid#52898PurposeYpdI* is fused to the IFP-F[2] by (GGGGS) X 2. Ypd1*/Skn7t: no signal, Ypd1*/Ssk1t: weak signal. Internal ClaI site in Ypd*I. Plasmid confers ampicillin resistance to DH5α.DepositorInsertYpd*1-L-IFP-F[2]
TagsL-IFP-F[2]ExpressionYeastMutationChanged Tryptophane 80 to AlaninePromoterGAL1Available SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
TALEN-CCR5L18-NtermN3
Plasmid#51448PurposeExpresses TALEN targeting left CCR5A site (L18) with N3 N-terminal domainDepositorInsertTALEN CCR5 Left (L18) N3 N-term
UseTALENTags3xFLAG and Fok1 EL variantExpressionMammalianMutationK150Q, K153Q, and R154QPromoterCMVAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
TALEN-CCR5R18-NtermN3
Plasmid#51449PurposeExpresses TALEN targeting right CCR5A site (R18) with N3 N-terminal domainDepositorInsertTALEN CCR5 Right (R18) N3 N-term
UseTALENTags3xFLAG and Fok1 KK variantExpressionMammalianMutationK150Q, K153Q, and R154QPromoterCMVAvailable SinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEBG MKK3b (Glu)
Plasmid#50451Purposeactivates p38 in the signaling pathwayDepositorInsertMKK3b (MAP2K3 Human)
TagsGstExpressionMammalianMutationchanged Serine 218 to Glutamic Acid, changed Thre…PromoterSV40Available SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
1287 p3E-mut let-7 etv2 3’ UTR
Plasmid#49011PurposeZebrafish Long length etv2 3' UTR with five let7 binding site mutations in gateway 3' Entry vectorDepositorInsertets variant gene 2 (etsrp Zebrafish)
UseGateway 3' entryMutationMutated the Let7 miRNA binding sitesAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
pRLCon1288-1666
Plasmid#31448DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRLCon183-221_850-1207
Plasmid#31449DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRLCon183-221mut2_850-1207
Plasmid#31450DepositorInsertHNF4A 3'UTR fragments (HNF4A Human)
UseLuciferaseExpressionMammalianMutationmut2 in balancerAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRLCon1-449_850-1207
Plasmid#31451DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS2 xWnt11
Plasmid#24973DepositorInsertWnt11 (wnt11 Frog)
ExpressionMammalianAvailable SinceJune 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-16
Plasmid#172746PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-16; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-16
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-polyQ23-NLS
Plasmid#231891PurposeExpression of non-aggregated HTT partial exon 1 Q23-NLS in the nucleusDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQFlag-USP7 WT puroR
Plasmid#46751PurposeRetroviral vector that expresses wild type Flag-tagged human USP7DepositorAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEVOL_PylRS(WT)-tRNA
Plasmid#223512PurposePylRS (WT)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialPromoteraraBAD, rrnB, and glnS and proKAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-mEGFP
Plasmid#175293PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mEGFP
TagsmEGFPExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Human MAC-1 alpha
Plasmid#8631DepositorInsertMAC-1 alpha (ITGAM Human)
ExpressionMammalianAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
EGFR WT
Plasmid#11011PurposeRetroviral construct for expressing human EGFR in human cellsDepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-mRuby2
Plasmid#175294PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mRuby2
TagsmRuby2ExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV/D377Y-mPCSK9
Plasmid#58376PurposeExpresses GoF mutant murine PCSK9 to be used for rAAV8-mediated gene transfer, hypercholesterolemia and atherosclerosisDepositorHas ServiceAAV8Insertproprotein convertase subtilisin/kexin type 9 (Pcsk9 Mouse)
UseAAVExpressionMammalianMutationD377YPromoterHCRApoE/hAATAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV/D374Y-hPCSK9
Plasmid#58379PurposeExpresses GoF mutant human PCSK9 to be used for rAAV8-mediated gene transfer, hypercholesterolemia and atherosclerosisDepositorHas ServiceAAV8Insertproprotein convertase subtilisin/kexin type 9 (PCSK9 Human)
UseAAVExpressionMammalianMutationD374YPromoterHCRApoE/hAATAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB
Plasmid#154473PurposeExpresses dCas9 fused to mCherry and the KRAB domain of ZIM3DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterSFFVAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-NG
Plasmid#138566PurposeExpresses human codon-optimized rationally engineered SpCas9 variant and blasticidin resistance: EFS promoter-SpCas9-NG-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NG
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationL1111R, D1135V, G1218R, E1219F, A1322R, R1335V, T…PromoterEFSAvailable SinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAL119-TK
Plasmid#21911DepositorInsertHSV Type 1 thymidine kinase
UseAdenoviralAvailable SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
MSCV-XZ066-EGFRvIII
Plasmid#20737DepositorInsertEGFRvIII (EGFR Human)
UseRetroviralExpressionMammalianMutationEGFR with a 267 amino acid deletion in the extrac…Available SinceMarch 31, 2009AvailabilityAcademic Institutions and Nonprofits only -
SepRS(2)/pSertRNA(B4)/EF-Sep
Plasmid#173897PurposeThe plasmid contains an orthogonal aminoacyl-tRNA synthetase/tRNACUA pair, which directs the efficient incorporation of phosphoserine (pSer) into recombinant proteins in Escherichia coli.DepositorInsertsSepRS(2)
pSertRNA
EF-Sep
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab4a-7
Plasmid#56440PurposeLocalization: Ras GTPase, Excitation: 488, Emission: 507DepositorAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEVOL_PylRS(AF)-tRNA
Plasmid#223511PurposePylRS (AF)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialMutationY306A; Y384FPromoteraraBAD, rrnB, and glnS and proKAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaM-4
Plasmid#172770PurposeBacterial expression of anti-mCherry nanobody LaM-4, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-4
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 BRGI-Flag
Plasmid#19143DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4 Human)
TagsFlagExpressionMammalianAvailable SinceSept. 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-REDD1-HA
Plasmid#133550PurposeExpresses HA tagged REDD1 in Mammalian cellsDepositorInsertRegulated in development and DNA damage response 1 (REDD1) (DDIT4 Human)
UseRetroviralTagsHA tagExpressionMammalianAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_eCB2.0
Plasmid#164604PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in neuronsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterhSynAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS_cAMPFIRE-H
Plasmid#182285PurposeMammalian expression of the cAMP sensor cAMPFIRE-H under a CAG promotor w/ WPRE translation enhancer.DepositorInsertcAMPFIRE-H (cAMP sensor)
ExpressionMammalianAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLF2-GFP-3xFLAG
Plasmid#230986PurposeExpresses GFP tagged MLF2 in mammalian cellsDepositorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-TET1
Plasmid#83568PurposeExpresses TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-N2-Frankenbody-HA
Plasmid#175292PurposeVisualize endogeneous loci coupled with ZF probes harboring 10xHA tagDepositorInsertanti-HA frankenbody fused with mCherry
TagsmCherryExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pADH99Cau
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi1-LgB91
Plasmid#134342PurposeNanoluc complementation assay. Expression of Gαi1 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi1. Addition of the HA epitope at N terminus of Gαi1.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
3541 pMIG Bcl-XL
Plasmid#8790DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
CMV-mCherry-3’UTR of β-actin-(F30-2xdBroccoli)6
Plasmid#190162PurposeExpresses 24 Broccoli-tagged beta-actin mRNA in mammalian cellsDepositorInsertmcherry_(3'UTR, No Actin)_24Broccoli
Tags24×BroccoliExpressionMammalianPromoterCMVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-Halo
Plasmid#175296PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with HaloTag
TagsHaloTagExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CAG-hCA4-miR122
Plasmid#244908PurposeAAV transgene plasmid encoding human CA4 with miR-122 target siteDepositorInserthuman CA-IV
UseAAVAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only