We narrowed to 5,937 results for: plasmid dna
-
Plasmid#170362PurposePlasmid used for Crispr/cas9 based disruption of human DNMT1.DepositorInsertCas9-T2A-GFP
UseLentiviralAvailable SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCL.177
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
QSOX1-luciferase
Plasmid#113352Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of QSOX1 geneDepositorInsertQSOX1-enhancer (QSOX1 Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCL.180
Plasmid#185001PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNADepositorInsertEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationAAVS1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP9A-luciferase
Plasmid#113354Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of ATP9A geneDepositorInsertATP9A-enhancer (ATP9A Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-miR-34 MT
Plasmid#78259PurposepsiCHECK2 dual luciferase reporter harboring a mutated miR-34 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorInsertmutated miR-34 target site
UseLuciferase; Microrna activityExpressionMammalianMutationnucleotides 2-5 and 10-11 changed from CCGT to GG…Available SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KMT2B
Plasmid#101070PurposeDonor vector for 3' FLAG tag of human KMT2BDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZJQIBEBT003
Plasmid#140053PurposeThe pZJQIBEBT003 plasmid contains the coding sequence of eMutS-L157C-G233C gene which has the ability of error removal in the gene synthesis process.DepositorInserteMutS-L157C-G233C-CBM-EGFP
TagsHis-TagExpressionBacterialMutationL157C, G233CPromoterT7Available SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6.gLacZ.Cas9-T2A-GFP
Plasmid#170361PurposeNegative control plasmid used for Crispr/cas9 based disruption.DepositorInsertCas9-T2A-GFP
UseLentiviralPromoterU6Available SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_ARID4B
Plasmid#101072PurposeDonor vector for 3' FLAG tag of human ARID4BDepositorAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_RERE
Plasmid#101069PurposeDonor vector for 3' FLAG tag of human REREDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RERE_1
Plasmid#101073PurposeEncodes gRNA for 3' target of human REREDepositorInsertgRNA against RERE (RERE Human)
UseCRISPRAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-TAF1-A
Plasmid#247346PurposeExpresses SpCas9 and a sgRNA targeting the human TAF1-A loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_ETV2_Down-Tandem
Plasmid#241393PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of ETV2DepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Nme2-U6-sgRNA scaffold
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA201
Plasmid#216026PurposeFragmid fragment: (Cas protein) firefly luciferaseDepositorHas ServiceCloning Grade DNAInsertFluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA156
Plasmid#216022PurposeFragmid fragment: (Cas protein) Nanobody binds ALFA tagDepositorHas ServiceCloning Grade DNAInsertNbALFA_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA349
Plasmid#216032PurposeFragmid fragment: (Cas protein) Renilla luciferaseDepositorHas ServiceCloning Grade DNAInsertRluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_V222A RAD23B
Plasmid#201580PurposeExpresses a variant of human RAD23B containing mutation V222A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationContains mutation V222AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_F400A RAD23B
Plasmid#201581PurposeExpresses a variant of human RAD23B containing mutation F400A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationContains mutation F400AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_ARID4B_1
Plasmid#101078PurposeEncodes gRNA for 3' target of human ARID4BDepositorInsertgRNA against ARID4B (ARID4B Human)
UseCRISPRAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p-att-ef1a-MS2-RecT-dCas9-BSD
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c043
Plasmid#139766PurposeProtein expression/Streptavidin pull-downDepositorInsertTBXT, DNA-binding domain, WT (TBXT Human)
TagsAvi-tag (Biotin) and His6-TEVExpressionBacterialMutationContains only amino acids E41- D225PromoterT7Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c044
Plasmid#139767PurposeProtein expression/Streptavidin pull-downDepositorInsertTBXT, DNA-binding domain, G177D (TBXT Human)
TagsAvi-tag (Biotin) and His6-TEVExpressionBacterialMutationG177D; contains only amino acids E41- D225PromoterT7Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTF-ahpC-rfp
Plasmid#153035PurposeFor CRISPR-Cas12a genome editing in E. coli. Contains a constituitively expressed CRISPR array targeting the ahpC gene in E. coli and donor DNA to insert an rfp translational fusion in the ahpC gene.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTF-lacZ-rfp
Plasmid#153037PurposeCRISPR-Cas12a genome editing in E. coli. Contains a constitutively CRISPR array targeting the lacZ gene in E. coli genome and donor DNA to insert an constitutively expressed rfp reporter gene.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
GRLF1
Plasmid#36195PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertGRLF1 (Codon Devices Synthesized) (ARHGAP35 Human)
TagsHis tag with TEV cleavageExpressionBacterialMutationContains the Ras homolog domain only (amino acid …Available SinceJune 19, 2012AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTS2373-Tier1-PhCMV-Gal4
Plasmid#169581PurposeTier-1 vector encoding PhCMV-driven Gal4 DNA binding domain (PhCMV-Gal4-pA).DepositorInsertregulatory protein GAL4
ExpressionMammalianPromoterPhCMVAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-XL-AncBE4max
Plasmid#136254PurposeDoxycycline inducible piggyBAC plasmid for mammalian expression of cytosine base editor AncBE4maxDepositorInsertAncBE4max_GFP
UseCRISPR; Piggybac dna transposonExpressionMammalianMutationThe AncBE4max_GFP insert was PCR amplified from a…PromoterTRE3GAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
NanoLuc-TCF4(biased)-beta-Catenin-HaloTag Bidirectional Vector
Plasmid#238680PurposeExpress NanoLuc-TCF4(biased)-beta-Catenin-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationbiasedPromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBiT EGFR(1-673) Assay, BiBiT vector
Plasmid#238756PurposeExpress EGFR(1-673) Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsLgBiT and SmBiTExpressionMammalianMutation(1-673)PromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET Assay Vector, NanoLuc-KRAS(G12V)
Plasmid#236859PurposeExpress NanoLuc(R)-KRAS(G12V) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertKRAS (KRAS Human)
TagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationG12VPromoterCMVAvailable SinceSept. 22, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET Assay Vector, BiBRET CRAF-BRAF
Plasmid#238574PurposeExpress CRAF-BRAF Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits