We narrowed to 2,240 results for: ARP
-
Plasmid#122102PurposeAAV-mediated expression of Chronos-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF2698
Plasmid#142977PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX LYCHOS (GPR155) WT-FLAG
Plasmid#199633PurposeLentiviral construct to stably express LYCHOS (GPR155) WTDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2: Pnos:ER:lexABD:GAL4AD:T35s-OplexA:mini35S:phi31:Tnos-Pnos:GR:LacIBD:Gal4AD:Tnos-OplacI:mini35S:RDF:Tnos (GB1679)
Plasmid#160619PurposeModule for estradiol-inducible expression of the PhiC31 integrase gene and dexamethasone -inducible expression of PhiC31 phage recombination directionality factor (RDF) gene.DepositorInsertERLexABDGal4AD / PhiC31 / GRLacIBDGal4AD / RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-PSMB5-PSMB6-PSMB7
Plasmid#217898PurposeInsect cell expression of human 20S CP proteasome subunit beta type-5 (PSMB5), beta type-6 (PSMB6), and beta type-7 (PSMB7)DepositorAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26:gRNA 4 (Pnos):2.1 aptamer (GB1724)
Plasmid#160621PurposeTarget for the Nopaline Synthetase Promoter with the MS2 recognition 2.1 loop in position3' in the scaffoldDepositorInsertU6-26:gRNA 4 (pNos): 2.1 aptamer
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP GFP-MOSPD2 W201E
Plasmid#186471PurposeExpression of human MOSPD2 (mutant W201E, unable to bind lipid droplets) fused to EGFP in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationW201E (no more binding to lipid droplets)Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) WT-myc
Plasmid#199684PurposeTransient expression of LYCHOS (GPR155) WTDepositorAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) 4CA-HA
Plasmid#199677PurposeTransient expression of LYCHOS (GPR155) C595.604.629.638A mutantDepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationC595.604.629.638 mutated to APromoterCMVAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 LYCHOS (GPR155) ∆Permease-HA
Plasmid#199686PurposeTransient expression of LYCHOS (GPR155) ∆PermeaseDepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationDeletion from amino acid 1-369PromoterCMVAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 LYCHOS ∆LED-HA
Plasmid#199682PurposeTransient expression of LYCHOS (GPR155) ∆LED-HADepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationDeletion from amino acid 556-651PromoterCMVAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) FP>IA-HA
Plasmid#199661PurposeTransient expression of LYCHOS (GPR155) FP>IA mutantDepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationF43 and P44 mutated to I and APromoterCMVAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-GFP
Plasmid#122098PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-VAPA
Plasmid#255771PurposeHuman VAPA with FLAGDepositorAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP6 57-98
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3379
Plasmid#144855PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB-CG-LYCHOS WT-HA-GFP
Plasmid#199687PurposeExpression of LYCHOS WT in insect cellsDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) ∆DEP-HA
Plasmid#199683PurposeTransient expression of LYCHOS (GPR155) ∆DEP-HADepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only