We narrowed to 5,049 results for: Mos
-
Plasmid#68656PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsTagRFPExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pSC201
Plasmid#129387PurposeA variant of the pSCrhaB2 vector with the oriR6K and mob genes from pGPΩ-TP. Used for homologous recombination of the rhamnose-inducible system into the chromosome of Burkholderia cenocepacia K56-2.DepositorInsertoriR6K and oriT
ExpressionBacterialMutationN/APromoterN/AAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR33
Plasmid#69254Purposephsp16.2::CRE for integration on ttTi14024, Chr XDepositorInsertCre recombinase
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterhsp16.2Available SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB6677
Plasmid#106155PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6632, integration into Yarrowia lipolytica chromosomal location IntE_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB135
Plasmid#68589PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsTagRFPExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB230
Plasmid#68621PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagstdTomatoExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB6684
Plasmid#106154PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6631, integration into Yarrowia lipolytica chromosomal location IntD_1, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB6631
Plasmid#106161PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6684 into Yarrowia lipolytica chromosomal location IntD_1, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH652-RLuc/maxFLuc
Plasmid#29698DepositorInsertFirefly Luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…Available SinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
MTK678_002
Plasmid#123923PurposeEncodes the TU GFP dropout cassette with Ampicillin resistance and bacterial artificial chromosome as a type 678 part to be used in the MTK systemDepositorInsertBAC-AmpR
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR47
Plasmid#69258Purposepmyo-3::CRE for integration on ttTi14024, Chr XDepositorInsertCre recombinase
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promotermyo-3Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB6682
Plasmid#106152PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6627, integration into Yarrowia lipolytica chromosomal location IntC_2, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB206
Plasmid#68597PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsCitrineExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSEM232 - [Pmlc-1 | tagRFP-T (2x NLS)| cbr-tbb-2 UTR]
Plasmid#159898PurposeFluorescent co-injection marker to identify extrachromosomal arrays in C. elegansDepositorInsertPmlc-1 | tagRFP-T (2x NLS)| cbr-tbb-2 UTR
ExpressionWormAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB6679
Plasmid#106158PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6638, integration into Yarrowia lipolytica chromosomal location IntE_4, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB211
Plasmid#68602PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTags3xFLAGExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCoofy62
Plasmid#122014PurposeMammalian vector for parallel SLIC cloning containing the VEGF signal sequence for secretion, N-terminal His6-Smt3Star (SumoStar*) and different C-tag optionsDepositorTypeEmpty backboneTagsHis6-Smt3Star and Multi3: depending on the LP2 pr…ExpressionMammalianAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBM23-pyrF-NT
Plasmid#174384PurposepBM23 contained pyrF and mini-CRISPR.DepositorInsertpyrF-NT
UseTemplate for cloning fragments for chromosomal in…ExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBM23-pyrF-CS
Plasmid#174396PurposepBM23 contained pyrF and mini-CRISPR.DepositorInsertpyrF-CS
UseTemplate for cloning fragments for chromosomal in…ExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSR35
Plasmid#69256Purposephsp16.41::CRE for integration on ttTi14024, Chr XDepositorInsertCre recombinase
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterhsp16.41Available SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB6681
Plasmid#106157PurposeEasyCloneYALI system-based yeast integrative vector for markerfree integration via CRISPR/Cas9 to be used in combination with pCfB6637, integration into Yarrowia lipolytica chromosomal location IntE_3, USER site for cloning, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTUT1
Plasmid#60038PurposeMammalian expression of FLAG-tagged mouse TUT1DepositorAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSR28
Plasmid#69253Purposephlh-8::CRE for integration on ttTi14024, Chr XDepositorInsertCre recombinase
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterhlh-8Available SinceOct. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB330
Plasmid#68658PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagstdTomatoExpressionPlantPromoterCauliflower mosaic virus 35S promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GFP (F64L, S65T, V163A)-kanMX6
Plasmid#53183Purposechromosomal tagging with stable GFPDepositorInsertkanMX6
UseYeast genomic targetingTagsGFP (F64L, S65T, V163A)Available SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-C11orf83-V5
Plasmid#65843PurposeMammalian expression of C terminally V5-tagged C11orf83/UQCC3DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTUT6
Plasmid#60043PurposeMammalian expression of FLAG-tagged mouse TUT6DepositorAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCALNL_Ch10
Plasmid#81224PurposepCALNL reporter contains two target sites consisting of PAM Cas9 site-gix psuedo site-Cas9 site-PAM that match region in PCDH15 locus on chromosome 10DepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSR21
Plasmid#69156Purposeread-outlox2272 mCherry to tagBFP switch for integration on ttTi14024, Chr XDepositorInsertsmCherry
TagBFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterrps-27Available SinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-UnaG-FLAG
Plasmid#203479PurposeFor Agrobacterium transformation. A plastid transit peptide fused UnaG-FLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertPlastid transit peptide fused UnaG-FLAG
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB511-TP-tagRFP
Plasmid#203482PurposeFor Agrobacterium transformation. tagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertTagRFP flanked with an N-terminal plastid transit peptide and a C-terminal FLAG tag.
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB560-NADK2
Plasmid#203760PurposeFor Agrobacterium transformation. tagRFP fused Arabidopsis thaliana NAD KINASE2 (NADK2) under the control of the cauliflower mosaic virus (CaMV) 35S promoter.DepositorInsertNAD KINASE2
ExpressionBacterial and PlantAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMLS640
Plasmid#188892PurposettTi5605 MosSci targeting vector with Pmex-5::Cas9 and floxed Cbr-unc-119 markerDepositorInsertPmex-5::Cas9, Cbr-unc-119
ExpressionWormMutationC. elegans codom optimization and intron additionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lmajor_gp63_10_0460_P460G_D463N_S465A
Plasmid#171645PurposeExpression of L. major glcyoprotein-63 (P460G_D463N_S465A) with substrate binding site mutations from chromosome 10 in mammalian cellsDepositorInsertLmjF.10.0460 P460G D463N S465A
TagsMyc-HisExpressionMammalianMutationP460G; D463N; S465AAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT.334
Plasmid#119556PurposeLevel T acceptor vector for chromosomal integration with lacZ compatible with blue/white screening. Modified pUC19 vector.DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoA
Plasmid#117990PurposeChloroplast-targeted expression of CURT_fluoA controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoA
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoB
Plasmid#117991PurposeChloroplast-targeted expression of CURT_fluoB controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoB
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CTP-fluoE
Plasmid#117992PurposeChloroplast-targeted expression of CURT_fluoE controlled by the CaMV 35S promoterDepositorInsertCTP-CURT_fluoE
UseSynthetic Biology; Plant/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pN_35S/CURT_flouB
Plasmid#117995PurposeExpression of CURT_flouB controlled by the CaMV 35S promoterDepositorInsertCURT_flouB
UseYeast/bacteria binary vectorExpressionPlantPromoterCauliflower mosaic virus 35SAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB6637
Plasmid#106164PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6681 into Yarrowia lipolytica chromosomal location IntE_3, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pCS2-UTX-F
Plasmid#17438PurposeExpression of UTX in mammalian cellsDepositorAvailable SinceFeb. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGG-cTP-TurboID-GFP
Plasmid#209403PurposeTransiently expressing and visualizing the subcellular localization of TurboID fused with a chloroplast transit peptide (cTP) in plantaDepositorInsertPM-3XHA-TurbOID
TagsGFPExpressionPlantPromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pL
Plasmid#196286Purpose35S promoter-driven expression of the positive-sense TSWV L RNA segment encoding codon-optimized L (RdRp)DepositorInsertFull length TSWV L antigenome encoding codon-optimized L (RdRp)
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL17
Plasmid#106483PurposepDL17 is based on conditionally replicating backbone derived from pQE-30 and expresses gam, bet and exo genes under control of PrhaB promoter for efficient dsDNA integration into E. coli chromosomeDepositorInsertsgam
bet
exo
lacI
rhaR
rhaS
ExpressionBacterialAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1(+)-NEMOm
Plasmid#189930PurposeMammalian expression of calcium sensor with ultra-high dynamics and sensitivityDepositorInsertNEMOs
ExpressionMammalianPromoterCMVAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA-puro
Plasmid#180426PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.DepositorInsertgRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJWV102-PL-dCas9
Plasmid#85588PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9spDepositorInsertdCas9sp
UseCRISPRExpressionBacterialPromoterPLspAvailable SinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW31
Plasmid#136423PurposeContains genes of Type I-C CRISPR-Cas system for inducible expression and chromosomal integration at attTn7DepositorInsertsCas5
Cas8
Cas7
Cas3
Cas3
UseCRISPRAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only