We narrowed to 5,049 results for: Mos
-
Plasmid#168464PurposeFor the insertion pf NLS-mEos3.2-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mEos3.2-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_nocharge_wR
Plasmid#139119Purposeexpress hnRNPA2 LC with no charged residues with R added backDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
Tags6His-TEVExpressionBacterialMutationR47APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_EB
Plasmid#66013PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [E:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_FB
Plasmid#66014PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [F:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_GB
Plasmid#66015PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [G:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5A-K5A N23 C11orf83-GFP
Plasmid#65846PurposeMammalian expression of the mutated N terminal part (R5A-K5A N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5D-K6D N23 C11orf83-GFP
Plasmid#65847PurposeMammalian expression of the mutated N terminal part (R5D-K5D N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Magoh198delG
Plasmid#30481DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGD-p19
Plasmid#196326Purpose35S promoter-driven expression of the tomato bushy stunt virus p19 RNA silencing suppressorDepositorInserttomato bushy stunt virus p19
ExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGD-P1/HC-Pro
Plasmid#196328Purpose35S promoter-driven expression of the tobacco etch virus P1/HC-Pro RNA silencing suppressorDepositorInserttobacco etch virus P1/HC-Pro
ExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCK306
Plasmid#110544PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.DepositorInsertsPrhaBAD
yfp
rhaS
ExpressionBacterialPromoterN/A, PrhaBAD, and kanR promoter (upstream of kanR…Available SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
ExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNMSB104
Plasmid#199314PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB84
Plasmid#199309PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elega…Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-linker-TlcnC
Plasmid#114377Purposeexpresses Flpo recombinase-dependent GtACR2-Kv2.1C-linker-TlcnC, which targets GtACR2 to the somatodendritic compartment. Messier et al found this hybrid construct was the most effective at targetingDepositorInsertGtACR2-EYFP-Kv2.1C-linker-TlcnC (NEWENTRY )
UseAAVTagsEYFP and Kv2.1C-linker-TlcnCExpressionMammalianPromoterEf1aAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pTH728-CEN-RLuc/maxCFLuc
Plasmid#38212DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNMSB99
Plasmid#199308PurposeMosSCI insertion of myo-3p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertmyo-3p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChR2-HDRC::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, ChR2(H134R;D156C), C. elega…Promotermyo-3Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5-FRT-TO-SSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)_P2A_iLID-mCherry-RAB11
Plasmid#174647PurposeOptogenetic coupling of RAB11 to tetramerized moss kinesin-14 to induce retrograde transport of recycling endosomes. Compatible with Flp-in TREX system.DepositorInsertSSPB(micro)-mVenus-GCN4-ppKin14Vib(816-1321)-P2A-iLID-mCherry-RAB11
ExpressionMammalianMutationSSPB:Arg73Gln; mVenus: Met1Del, Thr154Met; ppKin1…PromoterCMV (with TetOn)Available SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
TP53RK gRNA (BRDN0001145338)
Plasmid#77699Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001146963)
Plasmid#77700Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRD439
Plasmid#168465PurposeFor the insertion pf NLS-mTurquoise2-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mTurquoise2-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag‐mTim3 (T1 truncation)
Plasmid#49210Purposeexpresses Flag tagged mouse Tim3 (T1 truncation)DepositorInsertTim3 T1 truncation (Havcr2 Mouse)
TagsFLAG and signal sequenceExpressionMammalianMutationT1 truncation ( contains all but the three most C…PromoterEF1aAvailable SinceDec. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001146381)
Plasmid#77701Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NC1 pGLUE WTX (1-804)
Plasmid#36956DepositorAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
ExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-cyp-33e1(C295A, C439A)-flag-tev-halo-his
Plasmid#227158PurposeFor T-REX experiments of cyp-33e1 C295A and C439A double mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertcyp-33e1 (cyp-33E1 Nematode)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 295 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8-CYP2A6(C82A, C439A)-flag-tev-halo-his
Plasmid#227163PurposeFor T-REX experiments of CYP2A6 C82A and C439A double mutant. Almost no sensing ability to reactive electrophilic species (RES).DepositorInsertCYP2A6 (CYP2A6 Human)
TagsFlag, HaloTag, and His6ExpressionMammalianMutationchanged cysteine 82 and cysteine 439 to alaninePromoterCMV and SP6Available SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiCh2-2
Plasmid#229021PurposeExpression of a CRISPRi doxycycline inducible control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only