We narrowed to 965 results for: REP
-
TypeCollection...sequences within exons, whereas CRISPR activation or repression experiments use targets within promoters. When...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...
-
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR... II-A CRISPR arrays capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas... -
Neuroscience
TypeCollection...responsibility of the authors and does not necessarily represent the official views of the National Institutes ... -
Synthetic Biology - Networks and Gene Regulation
TypeCollection.... Examples Include: promoters and terminators repressors and activators logic gates Networks and Gene ... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts A ... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...systems. Jump to Table: Cloning and Genomic Tools Reporters and Tags Library Construction Integration Recombination... -
Antibodies
TypeCollection...are expressed and purified from plasmids in our repository.... -
KLF Research Plasmids
TypeCollection... to mediate transcriptional activation and/or repression. Continuing collaborative efforts within the ... -
CRISPR Plasmids - Epigenetics
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts To... -
CRISPR Plasmids - RNA Editing
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Type... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Catalytically... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection..., yeast, or mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, ... -
CRISPR Plasmids - RNA Targeting
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Type... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts Identifying... -
Fluorescent Protein Guide
TypeCollection...is a Monomer not a Monomer? Addgene's plasmid repository contains a variety of fluorescent protein plasmids... -
CRISPR Plasmids - CRISPR Transposases (CAST)
TypeCollection...Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR-associated... -
All Antibodies
TypeCollection...responsibility of the authors and does not necessarily represent the official views of the National Institutes ... -
Institute for Protein Innovation
TypeCollection...Protein C, DYKDDDDK, Rho, His, Biotin, EE, GCN4 and Strep. Please visit our Tags and Other Markers Antibody... -
Malate Dehydrogenase CUREs Community Collection
TypeCollection...Organism or species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic... -
Synthetic Biology - Assembly Standards Guide
TypeCollection...ligates a promoter into an empty backbone can be repeated to ligate your gene of interest after the promoter...