Skip to main content
Addgene
Showing: 41 - 80 of 1009 results
  1. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...Proteins Localization See full Fluorescent Protein Guide NLS Nuclear Localization pENTR4-myc-nuc... FLAG and SV40 nuclear localization signal Myr Membrane Localization pWZL-Neo-Myr-Flag-DEST - ... optimized YFP tags for purification or localization experiments Yeast GAL4, PGK, ..., which allows you to visualize the cellular localization of your protein. Just remember that when... for C elegans expression GFP Localization pcDNA3-EGFP - C-terminal GFP ... vector that adds a C-terminal nuclear localization signal FNpcDNA3 - N-terminal ... the plasmid. Selectable Marker Typical Host Organism Representative Empty ...
  2. AAV for Neuronal Tracing

    Type
    Collection
    ...JA, Callaway EM. 2007b. Monosynaptic restriction of transsynaptic tracing from single, genetically targeted...present, the virus can spread from this cell to synaptically connected cells (meaning, it can spread to cells...complementation, G-deleted rabies virus can spread to monosynaptically connected cells. To further refine the targeting... was modified so that it could only infect a genetically specified neuronal population. This is done using...leukosis virus. EnvA can direct virus infection specifically into cells that express the TVA viral receptor...EnvA-pseudotyped RAVB is delivered to the starter cell, and specifically targets the starter cell via the EnvA receptor...References Wickersham IR, Finke S, Conzelmann KK, Callaway EM. 2007a. Retrograde neuronal tracing with a ...
  3. Plasmids for Stem Cell Research

    Type
    Collection
    ...differentiate into multiple cell types, but are typically limited to related cell lineages. Pluripotent ...organism. iPSC technology removes the possible ethical concerns related to embryonic stem cell use and...generation of iPSCs is relatively simple in concept: ectopically express a cocktail of stem cell reprogramming...Feeder-Free and Xeno-Free Culture Conditions: A Clinically Compliant Approach. Stem Cells Transl Med. 2015...pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proc Natl Acad Sci U S A. 2012 ...fibroblast reprogramming to cardiomyocytes using calcium activity as a functional measure of success. Mol.... Pereira Fibroblasts Neurons Lentiviral Human Chemical modulation of transcriptionally enriched signaling...
  4. Optogenetics Plasmid Collection

    Type
    Collection
    ...be used as an optical switch to control protein interactions, dimerization, localization or activity of...optogenetics plasmids such as microbial opsin and optical switch tools to measure and manipulate cells and...Fluorescent Protein Guide Microbial Opsin Plasmids Optical Switch Plasmids Background Optogenetics plasmids...the opsin in order to track its expression and localization. Many other types of proteins can also be controlled...response spectra) of different types of opsins and optical switches available in these tables, refer to Addgene's...Vector Type Promoter PI Publication Return to top Optical Switch Plasmids Browse, sort, or search the table...
  5. AAVED

    Type
    Collection
    ...goal of this year’s workshop is to brainstorm practical strategies for using combinations of AAV-based...result of the meeting will be a publicly shared practical guide for all scientists in the field and every...Organizing Committee: Dr. Constance Cepko, Harvard Medical School Dr. Melina Fan, Dr. Susanna Bachle, Dr. ...Addgene Confirmed Speakers Constance Cepko Harvard Medical School Ali Cetin Allen Institute for Brain Science...technology is used for targeted neuronal manipulation. Practical tips for using the technology in the lab (e.g....publication, we are asking participants to share practical information in the form of data and protocols ...publication's permission). Connie Cepko, Harvard Medical School Ali Cetin and Shenqin Yao, Allen Institute...
  6. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...it's usually more efficient than plasmid donor. Typical design is to have 50-80bp of homology arms on each... changes (>100bp insertions or deletions), we typically use plasmid donor, with two homology arms on each...transfection in cells like HEK, we use around 400ng of a typical size (~ 5kb) donor plasmid with Cas9/sgRNAs vector...plasmids. For ssDNA oligo design, the Zhang lab typically uses around 100-150bp total homology. The mutation..., giving 50-75bp homology arms. The Zhang lab typically use PAGE purified long oligos. For large changes...100bp insertions or deletions), the Zhang lab typically uses a plasmid donor, with two homology arms on...like HEK, the Zhang lab uses around 400ng of a typical size (~5kb) donor plasmid with Cas9/sgRNAs vector...
  7. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... by Talley Lambert at Harvard Medical School Zeiss Microscopy : Optical Highlighters NIC Wiki PSFP : Nikon...Protein Resources: FRET Biosensors Subcellular localization Michael Davidson Collection Blog: Which FP Should...Monomer? Background Fluorescent proteins are genetically encoded tools that are used extensively by life... proteins created by Talley Lambert at Harvard Medical School More References below Jump to: Blue/UV Cyan... tagging with a wide variety of colors, some specifically optimized for yeast Lindquist Lab Vectors - ...Nature Methods July 2016, Vol. 13(7):557-62 Olympus Confocal : The Fluorescent Protein Color Palette NIC Wiki... Shcherbakova et al. : Journal of the American Chemical Society, May 2012, Vol. 134 No.18, pp. 7913–7923...
  8. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...gRNA Design Tools CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic modifiers. Design your...domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates a programmable RNA editor...Insert Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify ...Selectable Marker PI Publication Visualize A catalytically inactive Cas9 (dCas9) fused to a fluorescent...
  9. Chemogenetics Plasmids

    Type
    Collection
    ...) domains that respond specifically to small molecules termed Pharmacologically Selective Effector Molecules.... Optogenetics Chemogenetics plasmids encode genetically engineered receptors that are activated by specific... to artificially activate or inhibit specific biological processes. Addgene’s collection contains two ...Activated by Designer Drugs (DREADDs) and Pharmacologically Selective Actuator Modules (PSAMs). DREADDs...have been engineered to respond to specific physiologically inert small molecules. There are four types...
  10. Deisseroth INTRSECT Collection

    Type
    Collection
    ..., excitatory and inhibitory opsins , genetically-encoded calcium indicators, and rabies targeting genes...doubly-specified combination of genetic and/or anatomical-defined parameters, by placing two orthogonal...fragments (which have become exons) determines the logical expression requirements of Cre and Flp (B,E). When...Fenno LE, Ramakrishnan C, Kim YS, Deisseroth K, Callaway EM, Oberhuber M, Conzelmann KK, Staiger JF. 2019...Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs. Cell Rep. 28(13):...Robertson K, Osten P, Sabatini BL. 2019. Distinct Cortical-Thalamic-Striatal Circuits through the Parafascicular...
  11. Genetic Code Expansion

    Type
    Collection
    ...incorporate a non-canonical amino acid into the protein of interest: The non-canonical amino acid, which...aaRS) that has been evolved to incorporate non-canonical amino acids (ncAAs). A plasmid containing the ...the gene of interest with the modified codon (typically the amber codon) that is recognized by the cognate...plasmids have been introduced in the cells, the non-canonical amino acid can be incorporated using the existing...acid onto the tRNA. The tRNA and synthetase are called an orthogonal set, because they should not crosstalk...the tRNA with a different amino acid. They are typically expressed from a single plasmid, with multiple...to specific stimuli, such as light. On a broader scale, the expanded genetic code can help us understand...
  12. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...to help identify guide sequences that minimize identical genomic matches or near-matches to reduce risk...band” is often too large to efficiently amplify. Typically use primers at least 100 bp from the predicted... to final volume of 50 μl. This reaction may be scaled down to a smaller final volume if necessary. Run...inoculate into a maxi-prep culture. Prep size may be scaled based on the required DNA yield. Perform maxi-prep...clones have sufficiently proliferated once macroscopically visible with ~2 mm diameter. Primer Validation...cells) before screening individual clones. It is critical that the deletion and non-deletion amplicons be...Masuda T, Maeda T, Paw BH, Orkin SH. Journal of Biological Chemistry . 2014. PubMed . Correction of a genetic...
  13. Neurodegeneration Research Collection

    Type
    Collection
    ...’s disease (PD) is a chronic and progressive neurological disorder that primarily affects movement. More...-wide association studies (GWAS) or other large scale studies. Researchers are now investigating the role...indicators with improved activation kinetics and localization for imaging synaptic transmission. Aggarwal ... transcription factors for sensory, motor, and cortical neuron differentiation. Held et al. Cell Rep. ...fluorescent proteins, including Markers of Subcellular Localization, Optogenetics Plasmids, and Chemogenetics Plasmids...(Link opens in a new window) A collection of neurological mouse models including complex and monogenic...
  14. Cre-lox system

    Type
    Collection
    ... Megason 13769 pCALNL-DsRed Cre dependent DsRed expression Mammalian Cepko 13770 pCALNL-GFP Cre dependent...Mammalian Sato 122961 pcDNA3.1_PA-Cre-Y324F Catalytically inactive PA-Cre CMV Mammalian Sato 123128 pET-His-Cre...140135 pAAV-EF1a-iCreV Split Cre fused to nuclear localized wild-type VVD EF-1 alpha AAV Zeng 140284 pCAG-...stop codon with loxP sites on either side (often called a “lox-stop-lox” or “LSL” cassette) upstream of...putting the loxP sites on either side of a gene (called “floxing”, for “flanked by loxP”), will permit ...excise the shRNA to return gene expression to physiological levels. In lox-STOP-lox shRNA constructs, Cre...which reporters are initially OFF and then probabilistically ON or OFF following Cre recombination to maximize...
  15. AAV Packaged on Request

    Type
    Collection
    ...collection in the serotypes listed here. Details Scale and Titer Packaged on Request can be ordered in ...preparations, we set both minimum standards and typical titers, though actual yields may vary by construct...construct. Size Quantity Total Volume Minimum Titer Typical Titer Small 10 × 100 µL aliquots 1 mL 4 × 10 12... with a minimum titer of 2 × 10 12 GC/mL and a typical titer of 7 × 10 12 GC/mL. For more details, see...providing scientist through an MTA. This process typically takes 1–4 days, depending on your institution....
  16. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...gRNA Design Tools CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator...Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...cleaved the target RNA sequence, they adopt an enzymatically active state and can bind and cleave additional...ID Plasmid Promoter PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify ...
  17. Viral Vectors

    Type
    Collection
    ...are the most popular virus for gene transfer in clinical trials. These viruses have a relatively high transduction...Overview of Viral Plasmids While plasmids are typically used to encode, propagate, and manipulate genetic...as a safety feature, viruses used in research typically do not have the ability to propagate in the same...plasmids, however, retains the properties of any typical plasmid and thus can be easily modified and amplified... For example, adeno-associated virus (AAV) is typically preferred for in-vivo studies because of its low...
  18. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...for Brain Science BRAIN Armamentarium Collection Caltech Systemic Capsids AAV Packaged on Request AAV Guide...following regions: Isocortex Hippocampal formation Cortical subplate Striatum Pallidum Hypothalamus Cerebellum...pAAV-AiE2051m-minBG-SYFP2-WPRE3-BGHpA AiP1277 AiE2051m SYFP2 Claustrum Cortical subplate 220711 pAAV-AiE2051m-minBG-iCre(R297T...R297T)-BGHpA AiP1786 AiE2051m Cre Claustrum Cortical subplate 230518 pAAV-AiE2051m-minBG-FlpO-WPRE-HGHpA ...pAAV-AiE2051m-minBG-FlpO-WPRE-HGHpA AiP1211 AiE2051m FlpO Claustrum Cortical subplate 191720 pAAV-AiE0743m_3xC2-minBG-SYFP2-WPRE3-BGHpA ...and transgenic mouse lines for genetic access to cortical cell types. bioRxiv [Preprint]. 2024 Sep 26:2024.06.10.597244...
  19. Zebrafish Plasmid Collection

    Type
    Collection
    ...horizontal stripes on the sides of the adult body, is a tropical freshwater fish in the minnow family. It has long...inflammation and infection, regeneration, human neurological disorders, microbiota studies, and drug discovery...Cell lineage tracing in multicellular systems typically relies on genetic markers, somatic mutations, ...types. CreLite - George Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that enables precise...assessment of lipoprotein abundance, size, and localization in high-throughput. MAZERATI platform - Leonard...
  20. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...consisting of a catalytically inactive form of Cas9 (dCas9) plus guide RNA (gRNA) for biochemical purification...analysis reveals genomic regulatory regions that physically interact with the Pax5 promoter in a chicken ...10.1093/dnares/dsx023. PubMed . Identification of physical interactions between genomic regions by enChIP-Seq...journal.pone.0123387. eCollection 2015. PubMed . A critical role of the Thy28-MYH9 axis in B cell-specific...
  21. Lentivirus Plasmids

    Type
    Collection
    ...divided among multiple plasmids. Some plasmids (typically called packaging and envelope plasmids) encode components...the plasmid that encodes the viral genome (typically called the transfer plasmid ). This table lists common...target cells. This genome is encoded by plasmids called "transfer plasmids," which can be modified to encode...
  22. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...to mentors, virtual and local professional development, membership to a local hub of educators teaching...Hypotheses in a Malate Dehydrogenase Oriented CURE. Callahan KP et al. CourseSource. 2022 Jan 14. DOI: 10.24918...Learning Gains and Positive STEM Attitudes in CUREs. Callahan KP et al. CBE Life Sci Educ. 2022 Dec;21(4):ar74...
  23. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...soluble recombinant molecules. The proteins are typically used in systematic protein interaction screens...Extracellular Interaction Screening (AVEXIS) for the scalable detection of low affinity extracellular receptor-ligand...Wright GJ. Genome biology 2009; 10(9):R99. Large-scale screening for novel low-affinity extracellular protein...Sun Y, Gallagher-Jones M, Barker C, Wright GJ. Analytical Biochem. 2012 May 1;424(1):45-53....
  24. Synthetic Biology - Overview

    Type
    Collection
    ...International Genetically Engineered Machine Foundation Registry of Standard Biological Parts - Repository...biology describes the rational engineering of biological systems for novel functions. Addgene is working...BioBricks BioBricks Foundation - Promoting open and ethical synthetic biology JBEI - Joint Bio-Energy Institute...
  25. CRISPR Plasmids - Yeast

    Type
    Collection
    ... Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used to purify ...
  26. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...the plasmid that encodes the viral genome (typically called cis -plasmid or transfer plasmid). Helper ...research is that it is replication-limited and typically not known to cause disease in humans. For these... biosafety levels and elicit relatively low immunological effects in vivo . While AAVs can be handled ...
  27. Qi Lab CRISPR Page

    Type
    Collection
    ...transcription on the gene expression level without genetically altering the target loci. Thus, CRISPRi is a ...Plasmid Description 44246 pdCas9-humanized A catalytically inactive, human codon-optimized Cas9 expression...expression plasmid 44247 pdCas9::BFP-humanized A catalytically inactive, human codon-optimized Cas9-BFP fusion...codon-optimized Cas9 constructs 44249 pdCas9-bacteria A catalytically inactive bacterial Cas9 expression plasmid 44250...
  28. COVID-19 Resources

    Type
    Collection
    ...novel virus strain from the Coronaviridae family called SARS-CoV-2. Scientists have been working at lightning... enzyme that cleaves precursor proteins to a biologically active state. The SARS-CoV-2 S protein contains...Cas13a ( pC013 ) for detection of SARS-CoV-2: A Scalable, Easy-to-Deploy, Protocol for Cas13-Based Detection...Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor . FURIN - Andersen,...
  29. CRISPR References and Information

    Type
    Collection
    ... : John Doench from the Broad Institute gives practical advice for designing your gRNA and introducing... Innovative Genomics Institute, University of California, Berkeley. CRISPR Software Sanger Indel Analysis...stickleback, tobacco, tomato, frog ( X. laevis and X. tropicalis ), and zebrafish. Off-Spotter: tool for CRISPR... mouse, rat, marmoset, pig, chicken, frog (X. tropicalis and X. laevis), zebrafish, sea squirt, Drosophila...
  30. Plan Your Experiment

    Type
    Collection
    ...EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain reporter gene (e.g. ...needs to match the target locus, but it is also critical to ensure that the gRNA target sequence does NOT...target with no homology elsewhere in the genome. Realistically, a given gRNA target sequence will have partial...additional sites throughout the genome. These sites are called off-targets and should be examined during gRNA ...
  31. Cell Migration Consortium Plasmids

    Type
    Collection
    ...deposited plasmids include: Joan Brugge , Harvard Medical School Klaus Hahn , UNC Richard Hynes , MIT Rick...University of Virginia Denise Montell , University of California, Santa Barbara Martin Schwartz , Yale University...University of Illinois Ron Vale , University of California, San Francisco Browse Plasmids ID Plasmid Gene...
  32. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Biosensors Optogenetics Background Fluorescent...to use these fluorescent proteins to modulate biological activity. Early tools allow scientists to regulate...transcription factors Connie Cepko See Plasmids Dronpa Optical control of protein activity Michael Lin See Plasmids...
  33. Michael Davidson Fluorescent Protein Collection

    Type
    Collection
    ... Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael Davidson from...the ORFs are of mammalian origin and include localization data found below. In addition, the Davidson ...Expressions website for additional images, tutorials, optical microscopy protocols and resources. Or read our...
  34. Luciferase Plasmid Collection

    Type
    Collection
    ...Resonance Energy Transfer (BRET) CalFlux VNT : An intracellular calcium sensor created by fusing NanoLuc...ability of a given lncRNA to cis-repress Mauro Calabrese 106253 pLS-mP-Luc Firefly Insertion of 5' promoter...Malcolm Moore 51819 Syn-ATP Firefly (modified) CMV Optical reporter of presynaptic ATP Timothy Ryan 24348 ...
  35. AAV Viral Preps

    Type
    Collection
    ...Archaerhodopsins Recombinases Cre, Flp, Dre Biosensors Calcium Sensors, Glutamate Sensors, Voltage Reporters Controls...retrograde Retrograde AAV To target projection neurons Caltech Systemic Capsids PHP.eB, PHP.S, PHP.V1, MaCPNS1...serotypes AAV1, AAV2, AAV5, AAV8, AAV9, AAVrg, the Caltech systemic serotypes, or others, it will be listed...
  36. Plant Plasmids and Resources

    Type
    Collection
    ...repository contains many plasmid tools that were specifically designed for use in plants. These resources ...MoClo Plant Parts II and Infrastructure Kit for hierarchical assembly of plant multigene constructs - Johannes...an Old Favorite External Resources Arabidopsis Biological Resource Center (ABRC) (Link opens in a new window...
  37. Lentiviral Prep Service

    Type
    Collection
    ...libraries to screen for genes involved in specific biological processes. For more information, see our Guide...pooled libraries 92379 Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A Human CRISPRa... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...
  38. Validated gRNA Sequences

    Type
    Collection
    ...GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut...TGAAGAAGATGGTGCGCTC 58255 cut S. pyogenes 24870050 Goncalves Emx1 H. sapiens 42337 cut S. pyogenes 23287718...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut...
  39. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...Resources: Empty Backbones Biosensors Subcellular localization Optogenetics Background Förster resonance energy...acceptor molecules and can therefore be used to calculate the distances between the donor and acceptor. ...were developed to be used as FRET standards to calibrate the numerous and disparate methods used to measure...
  40. CRISPR Plasmids - Plants

    Type
    Collection
    ... Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator... Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...
Showing: 41 - 80 of 1009 results