...mouse somatic cells. Cell Stem Cell. 2008 Feb 7. 2(2):151-9. Jaenisch Lentivirus Mouse Polycistronic, ... iPSCs by a synthetic self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54. Dowdy Adenovirus ...Nature of Induced Pluripotency. Cell. 2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of ...reprogramming in mouse. Cell Stem Cell. 2008 Mar 6. 2(3):230-40. Hochedlinger MMLV-derived Retrovirus Mouse...Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic...Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral Human ...

...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9... Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014. Epub 2014...

...known as RPS6KB1; Ribosomal protein S6 kinase B1 TSC1/2 TSC1 TSC2 Tuberous sclerosis VHL Von Hippel-Lindau...Rictor RPTOR independent companion of MTOR, complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return...disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID...cell and regulates the switch from anabolic to catabolic processes. Active mTORC1 promotes protein and ...energy-intensive processes. mTORC1 also blocks catabolic processes including autophagy and lysosome biogenesis... below. Color is used for clarity and does not indicate a specific relationship. The content for this ...Pathway Color is used for clarity and does not indicate a specific relationship. The content for this ...

... with 1. homology to the DNA flanking the DSB and 2. a specific edit close to the gRNA PAM site. When ...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter PI Publication Drosophila Plasmid... Marker PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans ... Marker PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish Plasmid...Marker PI Publication Xenopus Plasmid Gene/Insert Promoter Selectable Marker PI Publication Parasites ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

... mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an X-linked disorder...X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens in a new window... Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity... Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome. Neurology...males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67... disruptions, missense mutations located in the MBD, and truncations prior to the NID are more severe ...even within patients with the same mutation, the location and type of MECP2 mutation can be a strong predictor...

...different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals develop...study aggregation. Saha et al. Nat Commun. 2023 Feb 2. Study the C terminal domain of TDP-43 to better understand... rodent species. Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 ...with the iPSC toolbox . Lam et al. bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority... consists mainly of managing symptoms through medication and surgery. PD primarily involves the malfunction...available from Addgene, sortable by type of genetic modification and target species. You can also find our guide...

...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT...S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S. pyogenes 24967838 Mashimo...alpha 1 H. sapiens GAAGATCGGCCACTACATTC 74375 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens GAAGATCGGACACTACGTGC 74377 nick S. pyogenes...

...variety of modifications in endogenous loci with unprecedented speed and specificity. Figure 2: An overview...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...

...GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa...highly efficient gene modification. Maeder ML et al. Mol Cell. . 2008. Jul 25. 31(2):294-301. PubMed PMID...OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1...OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa ldr (low...CODA OPEN cAACCTCAGCATAAAGCTGGAGGAg psen2 OZ577 and OZ578 CODA OPEN cGGCATCTCCAGAGCCCGAGGCGGACc zgc:162148...hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc mdka (midkine-related growth factor) OZ527...lipoprotein receptor) OZ539 and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN...

...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox for...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...extensively validated for neuroscience research applications from the NeuroMab/Trimmer Lab Recombinant mAb...imaging. Learn more about antibodies and their applications in our Antibody Guide ! Cloning and Expressing...antibodies, and Fc-silent mutants. Functional diversification of hybridoma-produced antibodies by CRISPR/...456(1):527-33. Gavin Wright pET-30-based vector dedicated to efficient scFv expression, which circumvents...

...Regulation Ben Deverman 2:00 PM Cre-DOG and Combinatorial Strategies Connie Cepko 2:45 PM Break 3:00 PM (...contribute to this publication. Citation information for openly shared communication: Adeno-Associated ...Addgene's 2018 AAV Education and Development (AAVED) workshop series. The... The AAV Education and Development ...Details Date: Friday September 21, 2018, 9 AM - 5 PM Location: Addgene, 75 Sidney St, Cambridge, MA, 02139 Organizing...useful to help improve this technology or its application? What are some current obstacles that researchers...prepare and compile resources for this meeting's publication, we are asking participants to share practical...

...References PAM Sequences Glossary Publications CRISPR Overview Class 2 C lustered R egularly I nterspaced...systems enable researchers to target anywhere from 2 to 7 genetic loci by cloning multiple gRNAs into a... is included on the gRNA-containing plasmid, or a 2-plasmid system in which Cas9 must be delivered separately...library (panel E ). Remember - if you are using a 2-vector system, you will need to transduce cells that...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...either (1) a lack of gRNA and/or Cas9 expression or (2) a lack of efficient target cleavage in cells expressing...off-target effects by using a single Cas9 nickase and 2 different gRNAs, which bind in close proximity on ...

...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...make targeted epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic ... Marker PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...CRISPR plasmids for targeted epigenetic modification, including histone acetylation/demethylation, and...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...enhancer for your gene of interest. Available modifications include: histone acetylation by p300 histone...or MQ1 cytosine demethylation by Tet1 These modifications persist over time and are potentially heritable...

...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter PI Publication Plant Plasmid Gene... Marker PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9, or dCas9 fused to a transcriptional...

...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter PI Publication Drosophila Plasmid...Promoter PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans ...Promoter PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9 fused to a transcriptional activator...

...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...Marker PI Publication Bacteria Plasmid Gene/Insert Promoter Selectable Marker PI Publication Drosophila... Marker PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Description Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

...cells; function is unknown Monomer with a valency of 2 IgE Protects against parasites and is responsible ...such as anaphylactic shock Monomer with a valency of 2 IgG The most abundant isotype in blood, also found...secondary immune response Monomer with a valency of 2 IgG1; IgG2; IgG3; IgG4 IgM Produced during the primary... ranging from antibody fragments (shown in Figure 2) to completely unrelated molecules. Examples include...used for assembling protein nanostructures. Figure 2: An antibody (IgG, far left) compared to alternative...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification...

...expression of gRNA under control of the Drosophila U6:2 promoter Bullock 49410 pCFD3-dU6:3gRNA expression ...used for both generating knockouts and precise modifications using HDR. For more information about this project...

...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible with? CRISPR...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven... Tools for Affinity Purification These AAV encode tools for affinity purification (which can be used for...tet-off transactivators and tools for affinity purification (TRAP). Viral... Tools Tetracycline Transactivators Affinity Purification Cell Ablation Tetracycline Transactivators and...