We narrowed to 14,136 results for: eng
-
Plasmid#140084PurposeFusion of A. viridans lactate oxidase (LOX) and E. coli catalase (CAT) that converts lactate into pyruvate without producing H2O2.DepositorInsertA fusion of lactate oxidase from A. viridans and catalase from E. coli
TagsHis6ExpressionBacterialPromoterT7Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti-SpCas9 puro
Plasmid#104994PurposeThis 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance.DepositorInsertKpnI-XhoI-BsrGI-NheI
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSET-4xTR-TUBE
Plasmid#110312PurposeE. coli expression and purification of 4xTR-TUBEDepositorInsert4xTR-TUBE (UBQLN1 Human)
TagsN-terminal His6-T7 tagExpressionBacterialMutationAll Arg residues in the UBA domain are mutated to…PromoterT7Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330A-1x3
Plasmid#58767PurposeExpresses Cas9 nuclease and gRNADepositorInserthumanized S. pyogenes Cas9 nuclease
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCWori-A13AMO-aaCPRct
Plasmid#20117DepositorInsertAmorphadiene oxidase and p450 reductase
UseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
p3s-Cas9HC
Plasmid#43945DepositorInsertCas9
UseCRISPRTagsHA epitope and NLSExpressionMammalianPromoterCMVAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
p416 72Q GPD
Plasmid#1179DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ExRai-AktAR2
Plasmid#184047PurposeImproved excitation-ratiometric biosensor for monitoring Akt/Protein Kinase B activity in living cells.DepositorInsertExRai-AktAR2
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tagExpressionMammalianPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3a-T1
Plasmid#41821PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T1 target sequence) for genome engineeringDepositorAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBS31-cCARLIN
Plasmid#160928PurposeContains 10 constitutively expressed guide RNAs and CAG-GFP-CARLIN array sequence for DNA barcoding (when used in combination with Cas9)DepositorInsertCARLIN gRNAs and CAG-GFP-CARLIN array
UseMouse TargetingExpressionMammalianPromoterU6 promoter for gRNAs; CAG promoter for GFPAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse Drosha1
Plasmid#14780DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMAL-7xHis-TEV-hexa
Plasmid#222868PurposeExpresses His-tagged mutant (C19V/L56V/C110V/C130S/S135G/S219V) TEV protease in E. coliDepositorInsertTEV protease
Tags7xHis and MBPExpressionBacterialMutationC19V, L56V, C110V, C130S, S135G, S219V. Insert in…Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
shHIF2α(#2) (HIF2α-#2-pSUPER-retro-GFP/Neo)
Plasmid#22131DepositorInsertsynthethic oligonucleotide
UseRNAi and RetroviralExpressionMammalianMutationsynthethic oligonucleotide encoding shRNA targeti…Available SinceOct. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLSLGFP.R
Plasmid#51501PurposeSingle component LSL vector with GFP. Rep is expressed from the complementary sense LIR promoter. GFP is between LIR and SIR and is driven from a 2X35S promoter. Rep is within the repliconDepositorInsertGFP
UsePlant t-dna plasmidPromoter2x35SAvailable SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-CAG-RLuc
Plasmid#83280Purposerecombinant AAV vector packaging self-complementary Renilla Luciferase under the CAG promoterDepositorInsertRenilla Luciferase
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pG1AK-sfGFP
Plasmid#71739PurposeModular shuttle vector for Geobacillus and E. coliDepositorInsertsfGFP
UseSynthetic Biology; Shuttle vectorExpressionBacterialPromoterpRplsWTAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
V5-LOV-Turbo-NES
Plasmid#199545Purposeexpresses LOV-Turbo in the mammalian cytosol, lentiviral vectorDepositorInsertLOV-Turbo
UseLentiviralTagsNES and V5ExpressionMammalianPromoterTRE3GAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Human_TFAM_NoMTS_pET28
Plasmid#34705DepositorInsertTFAM (TFAM Human)
Tags6XHisExpressionBacterialMutationEncodes residues 43–246, corresponding to full-le…PromoterT7Available SinceFeb. 1, 2012AvailabilityAcademic Institutions and Nonprofits only