We narrowed to 19,393 results for: IRE
-
Plasmid#232479PurposeTetracycline inducible PiggyBac vector expressing bacterial TTHA1718 (TTHA) gene gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertThermus thermophilus HB8
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMX-Sox17-p2A-Erg-t2A-GFP
Plasmid#222496Purposemouse fibroblast-to-endothelial cell direct reprogrammingDepositorAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-mVenus-p27K−
Plasmid#176651PurposeIt encodes an mVenus fused to a mutant p27K-, which lacks binding affinity to Cdk. This reporter helps to identify quiescent disseminated tumor cells (in G0 phase of cell cycle).DepositorInsertmVenus-p27K- (Cdkn1b Mouse)
UseLentiviralTagsmVenusMutationMutant K- (lacks affinity to Cdk)Available SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-UbC-rtTA-Isl1_2A_Lhx3-BSD
Plasmid#226282PurposeTetracycline-inducible expression of Isl1 and Lhx3 for direct reprogramming of canine fibroblasts to induced-motor neuronsDepositorUseLentiviralTagsIsl1 and Lhx3 linked via T2AExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-UbC-rtTA-Ngn2_2A_Sox11-PURO
Plasmid#226284PurposeTetracycline-inducible expression of Ngn2 and Sox11 for direct reprogramming of canine fibroblasts to induced-motor neuronsDepositorUseLentiviralTagsNGN2 and SOX11 linked via T2AExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIN-PAmCherry-mSNCA-NE
Plasmid#102364PurposeLentiviral overexpression of PA-mCherry synuclein alpha fusionDepositorInsertsUseLentiviralTagsNEExpressionMammalianPromoterEF-1aAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1.sh.beta-catenin.1248
Plasmid#19761DepositorInsertsmall hairpin RNA against beta-catenin (CTNNB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceOct. 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
px552-U6-gRNA1-U6-gRNA2-CMV-eGFP
Plasmid#211760PurposePaired gRNAs (sgRNA1 and 2) targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.DepositorInsertgRNA1 and gRNA2 targeting VEGF-A (VEGFA Mouse, Human, M. mulatta (rhesus macaque))
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1.sh.beta-catenin.2279
Plasmid#19762DepositorInsertsmall hairpin RNA against beta-catenin (CTNNB1 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
NGFR P210
Plasmid#27486DepositorUseRetroviralTagsIRES and NFGRExpressionMammalianMutationContains the "complete" bcr/abl fusionAvailable SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P1 Promoter-FLuc
Plasmid#154266PurposeFirefly luciferase reporter containing the canonical Human IGF-1 P1 Promoter.DepositorInsertIGF-1 canonical P1 Promoter (IGF1 Human)
ExpressionMammalianPromoterHuman IGF-1 P1 PromoterAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q
Plasmid#184249PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertAtaxin-3 full length with 3 UIMs and 77Q in the Poly-Q track (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationCodon optimization for protein expression in BL2…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-EGFP-GPI-stop-L2
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Synthetic, Human)
UseExpression of a fluorescent membrane markerTagsEGFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
NGFR 210Y177
Plasmid#27487DepositorUseRetroviralTagsIRES and NGFRExpressionMammalianMutationTyrosine 177 mutated to Phenylalanine (Y177F)Available SinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P2 Promoter-FLuc
Plasmid#154267PurposeFirefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHLsec hSOD1
Plasmid#232481Purposevector for transient transfection expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
TagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCAGAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATX3 13Q- I77K Q78K W87K
Plasmid#185908PurposeExpresses ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-I77K, Q78K,W87K (N-terminal ) fused with His-Tag and TEV cleavage sequence (C-terminal).DepositorInsertataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track and point mutations I77K, Q78K and W87K (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationPoint mutations in Atx3 gene I77K Q78K and W87KAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P1 Promoter-FLuc2P
Plasmid#154261PurposeDestabilized firefly luciferase reporter containing the canonical Human IGF-1 P1 Promoter.DepositorInsertIGF-1 canonical P1 Promoter (IGF1 Human)
ExpressionMammalianPromoterHuman IGF-1 P1 PromoterAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P2 Promoter-FLuc2P
Plasmid#154262PurposeDestabilized firefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB-CuR-hSOD1
Plasmid#232477PurposeThe inducible PiggyBac Cumate Switch vector (PBQM812A-1 System Biosciences) expressing human SOD1gene including flag -tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-CuOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PIG-MycT58A
Plasmid#177648PurposeExpression of mouse Myc with T58A point mutationDepositorInsertMyc-T58A (Myc Mouse)
UseRetroviralTagsGFP and IRESExpressionMammalianMutationT58A point mutationAvailable SinceFeb. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
MLRV3:HRE-P53-MAPK/JNK-FOXO-TGFβ
Plasmid#178320PurposeMultiplex luciferase reporter vector, with luciferase reporters for the pathways HRE, P53, AP-1, FOXO and SMAD.DepositorInsertsHRE RedFirefly reporter
P53 FLuc reporter
AP-1 Renilla reporter
FOXO NLuc Reporter
SMAD GrRenilla reporter
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PIG-Myc
Plasmid#177650PurposeExpression of wild-type mouse MycDepositorAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tol2-pA-GI-wt1bDNNterm-E1b-5xUAS-E1b-eGFP-GI-pA-Tol2; gcryst:CFP
Plasmid#135766PurposeThis plasmid can be used to express independently eGFP and a zebrafish wt1b dominant negative isoform (N-terminal domain) from a bidirectional 5xUAS. Also CFP expression under crystallin promoter.DepositorAvailable SinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PCTK3
Plasmid#23710DepositorInsertPCTK3 (CDK18 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
dRMCE Plasmids
Plasmid Kit#1000000015PurposeTakes advantage of wild-type loxP and FRT sites present in these conditional alleles in mouse embryonic stem cells to introduce tags, reporters, and mutant coding regions into an endogenous lociDepositorAvailable SinceJuly 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLVX-NLS-HA-TurboID
Plasmid#215075PurposeExpresses NLS-HA-TurboID in mammalian cells from a lentiviral vector.DepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT_SigP:NLuc
Plasmid#197263PurposeCloning Backbone for INSPECT expression. Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette. Clone homology arms via Esp3I.DepositorTypeEmpty backboneUseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV40-EF1a-hBCL10-SO
Plasmid#75256Purposeretroviral expression vector for expression of StrepOne-Tagged human BCL10DepositorInsertBcl10 (BCL10 Human)
UseRetroviralTagsStrepOne TagExpressionMammalianPromoterpMSCV-LTRs, EF1aAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP1-C-Flag
Plasmid#134286PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP1DepositorInsertSREBP1 (Srebf1 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP1 isoform a precursorPromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMThy1.1_hDDX5_FL
Plasmid#88873Purposeconstitutive expression of DDX5 in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-N-3HA-SREBP2-C-Flag
Plasmid#134287PurposeLentivector encoding 3XHA (N-term) and Flag (C-term)-tagged SREBP2DepositorInsertSREBP2 (Srebf2 Mouse)
UseLentiviralTags3x HA and FlagExpressionMammalianMutationmouse SREBP2 precursorPromoterCMVAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1(201R2)-IV
Plasmid#102421PurposeInducible expression of siRNA resistant mouse Tet1-201 (Ensembl transcript ENSMUST00000050826.13) with HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 (Tet1 Mouse)
TagsHAExpressionMammalianMutationModified at the Dharmacon SMARTpool siRNA #2 targ…PromoterTetO-CMVAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV
Plasmid#102422PurposeInducible expression of siRNA resistant mouse Tet1-201 (ENSMUST00000050826.13) with mutated catalytic domain (H1620Y & D1622A), HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 catalytic domain mutant (Tet1 Mouse)
TagsHAExpressionMammalianMutationH1620Y and D1622A mutations in Tet1 catalytic dom…PromoterTetO-CMVAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT_5'-xrRNA_NLuc_3'-HCV-UTR
Plasmid#197265PurposeCloning Backbone for enhanced INSPECT expression (5' xrRNA + 3' HCV-UTR). Encodes for intronic IRES-driven NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette. Clone homology arms via BsaI.DepositorTypeEmpty backboneUseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT_5'-xrRNA_NLuc_3'-XAP1
Plasmid#197264PurposeCloning Backbone for enhanced INSPECT expression (5' xrRNA + 3' XAP1). Encodes for intronic IRES-driven NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette. Clone homology arms via BsaI.DepositorTypeEmpty backboneUseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMThy1.1_hDDX5_FL_D248N
Plasmid#88874Purposeconstitutive expression of DDX5 D248N in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:IL2_SigP:NLuc
Plasmid#197266PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human IL2 locus (exon 3). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertInterleukin-2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hH4-AVITEV
Plasmid#74051Purposeretroviral expression plasmid for human histone H4 with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman Histone-H4 (H4C16 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianPromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSCV Cdk2ap1CAN-HA
Plasmid#178030PurposeRetroviral vector for the purpose of overexpression in mammalian cell cultureDepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationFirst N-Terminal 27aa are deletedPromoterGAGAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-v2_SigP:NLuc
Plasmid#197268PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (long isoform only). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-v2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN2 BSD
Plasmid#92246PurposeTALEN targeting downstream of HTT gene (ELD) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN1 ZEO. TALEN: NN, HD, NN, NN, HD, NG, NN, NI, NN, NN, HD, NI, NN, HD, NI, NNDepositorInsertTALEN
UseTALENPromoterCAGAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only