We narrowed to 19,227 results for: Tat
-
Plasmid#63058PurposeExpresses the Fluorescence Lifetime Imaging Microscopy (FLIM)-compatible PKA activity sensor FLIM-AKAR in an AAV backboneDepositorInsertFLIM-AKAR
UseAAVExpressionMammalianPromoterEF-1αAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CaMKIIa-hChR2(C128S)-EYFP-WPRE
Plasmid#20294PurposeLentiviral expression of ChR2 (C128S) Step Function Opsin (SFO) fused to EYFP, for bi-stable optogenetic excitationDepositorInsertchannelrhodopsin-2
UseLentiviralTagsEYFPExpressionMammalianMutationchanged Cysteine 128 to SerineAvailable SinceMay 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CFLAR_WT_V5
Plasmid#82936PurposeGateway Donor vector containing CFLAR, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
BD2
Plasmid#37486DepositorInsertloxP-PGK-Hyg-loxP
UseIpsc gene targetingPromoterPGKAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLIK sh human Rb 1534 hyg
Plasmid#31500DepositorInsertRB shRNA (RB1 Human)
UseLentiviral and RNAiTagsEGFPExpressionMammalianMutationThe target sequence for shRB 1534 is GAACGATTATCC…Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
HA-ISceID44A
Plasmid#59424PurposeExpresses a catalytically inactive form of the endonuclease ISceIDepositorInsertendonuclease ISceI mutant (I-SceI )
TagsHA tagExpressionMammalianMutationchanged aspartate 44 to alanine (D44A)Available SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETconNK
Plasmid#81169PurposepETconNK Empty BackboneDepositorTypeEmpty backboneTagsc-mycExpressionBacterial and YeastPromoterGAL1Available SinceFeb. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
Eef1a-1955/-1>nls::Cas9::nls
Plasmid#59987PurposeEef1a (EF1alpha) promoter driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Eef1a (EF1alpha) -1955/-1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBiFCt-2in1-CN
Plasmid#105113Purposeratiometric BiFC analysis in plants (transient transformation)DepositorTypeEmpty backboneTagscYFP-HA and nYFP-MycExpressionPlantAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ151
Plasmid#69302PurposeGateway entry vector with pcoCas9D10ADepositorInsertpcoCas9D10A (Plant codon-optimized)
UseCRISPRTags2XFLAGMutationD10A mutation; NLS fusionAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-Nme/Nme2Cas9-sgRNA (KAC32)
Plasmid#133794PurposeU6 promoter sgRNA entry vector used for all NmeCas9 or Nme2Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Amrani et al. Genome Biology 2018DepositorInsertNmeCas9 and Nme2Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Amrani et al. Genome Biol…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-wt
Plasmid#110214PurposeExpression in mammalian cells of full-length wild-type SPRTN protein with a Flag-tag at N-terminus.DepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-39:RAB5A-mEGFP
Plasmid#107579PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human RAB5ADepositorInsertRAB5A Homology Arms with mEGFP-linker (RAB5A Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-HA-PQBP1
Plasmid#25804DepositorAvailable SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGR595
Plasmid#213785PurposeIntegrates at the CAN1 locus the BadBoy2 TP-DNAP1 variant and the Nourseothricin resistance marker. Includes an I-SceI transient expression cassette.DepositorInsertBadBoy2 TP-DNAP1
UseSynthetic BiologyExpressionYeastAvailable SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_D17
Plasmid#84611PurposeIntroduces DSB at D17 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR-Hyg
Plasmid#158708PurposeFor cloning and constitutive expression of crRNAs in mycobacteriumDepositorInsertcrRNA
UseCRISPR and Synthetic Biology; Mycobacteria expres…ExpressionBacterialPromoterHsp60Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-Tet1
Plasmid#85742PurposeshRNA against mouse Tet1DepositorInsertshRNA Tet1
UseAAVTagsEYFPAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only