We narrowed to 9,039 results for: sgRNA
-
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre sgAmotl2 v3
Plasmid#158602Purposelenti-viral construct with Cas9, Cre recombinbase and U6 driven sgRNA against mouse Amotl2DepositorInsertAmotl2 sgRNA
ExpressionMammalianPromoterU6Available SinceSept. 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-RAB7A
Plasmid#227297PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of RAB7A for knock-in.DepositorInsertsgRNA Targeting N-terminus of RAB7A (RAB7A Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
px330-GAPDH
Plasmid#136940PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4DepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_UQCRC2
Plasmid#177982Purposelentiviral vector expressing Cas9 and a sgRNA targeting UQCRC2DepositorInsertsgRNA targeting UQCRC2 (UQCRC2 Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
B52 + SPRTN sgSTOP
Plasmid#100709PurposeB52 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9-HF1
Plasmid#92115PurposeExpression plasmid for human codon-optimized dead/inactive high-fidelity SpCas9-HF1 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9-HF1 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, Q926APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGPT2_5
Plasmid#163455Purposelentiviral vector expressing Cas9 and an sgRNA targeting GPT2DepositorInsertsgRNA 5 targeting GPT2 (GPT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC42
Plasmid#66564PurposesgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 1XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLC-EGFP-RIP1
Plasmid#75163PurposeLentiCRISPR-EGFP with sgRNA targeting human RIPk1DepositorInsertRIPK1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
HeFSpCas9
Plasmid#92355PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-Gsk3b(new)
Plasmid#122341PurposeExpresses sgRNA targeting mouse Gsk3b and eSpCas9 in mammalian cellsDepositorInsertsgRNA for mouse Gsk3b
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
Plasmid#140205PurposeProof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.DepositorInsertsmCherry
sgRNA E1
UseCRISPR and Synthetic Biology; Proof-of-concept te…MutationG174DPromoterPelcA and U3Available SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-rac2-guides
Plasmid#168241Purpose"neutrophil specific GFP with ubiquitous rac2 sgRNAs"DepositorInsertrac2 sgRNAs
UseCRISPRAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR.sgKras.9
Plasmid#91894PurposesgRNAs targeting mouse Kras. 3rd generation lentiviral backbone.DepositorInsertKras sgRNA
UseLentiviralPromoterU6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dHeFSpCas9
Plasmid#92116PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive HeFSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, K848A, Q926A, K…PromoterCbhAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC625
Plasmid#62321PurposesgRNA with 1x MS2, Pol II promoter with ribozyme-gRNA-ribozyme design for yeast cellsDepositorInsertsgRNA +1x MS2, Pol II promoter with ribozyme cleavage
ExpressionYeastPromoterpAdhAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only