We narrowed to 4,533 results for: Gaa
-
Plasmid#36389DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only
-
mCherry-PH-SWAP70
Plasmid#84582PurposeExpresses mCherry-tagged PH-domain of SWAP70 in mammalian cells, binds to PI(3,4)P2DepositorInsertSWAP70 residues 209-306 (SWAP70 Human)
TagsmCherryExpressionMammalianMutationPleckstrin-homology domain, residues 209-306PromoterCMVAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Bmi1_3
Plasmid#36354DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSCL.177
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p CIneo-RL-Let7-3xBulgeB-mut
Plasmid#115369PurposeExpression vector to produce humanized Renilla luciferase with three mutated (seed-sequence mutations) partially complementary binding sites for human let-7 miRNA in the 3'UTRDepositorInsertRenilla Luciferase
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIN-U6-tracer_C9_1_-EF1a-Thy1.1-P2A-Neo
Plasmid#191397PurposesgRNA targeting alpha-satellites on human chromosome 9DepositorInsertsgRNA targeting alpha satellites on human chromosome 9
UseLentiviralExpressionMammalianPromoterU6Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB3053(gRNA X-2, XI-5, XII-4)
Plasmid#73295PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-pa-u6ac-Arhgap20-guides
Plasmid#254763PurposeArhgap20 gRNA for neutrophil specific KO in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGA-FT guide RNA1_7
Plasmid#246797PurposeA GreenGate entry vector containing a guide RNA expression cassette targeting the AtFT gene with 7 different gRNAsDepositorInsertAtU6-1 promoter-FT guide RNA1-AtU6-1 promoter-FT guide RNA3- (FT Synthetic, Mustard Weed)
UseCRISPR; Greengate cloning entry vectorExpressionPlantAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSTX4(1-271,272C)
Plasmid#206031PurposeBacterial expression of human Syntaxin 4 without transmembrane helix and a C-terminal cysteineDepositorInsertSyntaxin-4 (STX4 Human)
Tagshis-tag (removable with thrombin)ExpressionBacterialMutationdeleted amino acids 272-297 (encoding the transme…PromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-W308_guide-CBh-hSpCas9
Plasmid#188546PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid W308DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CFDP1 C12.4 gRNA
Plasmid#90625Purpose3rd generation lentiviral gRNA plasmid targeting human CFDP1DepositorInsertCFDP1 (Guide Designation C12.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-IL6
Plasmid#111933PurposeExpresses human interleukin-6 (IL6) fused to GFP in mammalian cellsDepositorInsertInterleukin 6 (IL6 Human)
TagsGFPExpressionMammalianMutationCodon optimized for expression in human cellsPromoterCMVAvailable SinceJuly 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
VAMP3-mCherry
Plasmid#92423PurposeExpression of VAMP3 C-terminally conjugated to mCherry.DepositorAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
VAMP8-mCherry
Plasmid#92424PurposeExpression of VAMP8 C-terminally conjugated to mCherry.DepositorInsertVAMP8 (Vamp8 Mouse)
TagsmCherryExpressionMammalianMutationA36S (Please see Depositor Comments below)PromoterCMVAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
WDFY2-GFP
Plasmid#193636PurposeExpresses GFP-tagged WDFY2 in mammalian cellsDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-irf3-shrna5
Plasmid#127649PurposeKnock-down of human IRF3DepositorInsertIRF3 shRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-Col1a1/GFP4_Seq1.2
Plasmid#201403PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shJUND puro
Plasmid#58698PurposeLentiviral shRNA vector for knockdown of human JUNDDepositorAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBirc5
Plasmid#160949PurposeBirc5 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PH-SWAP70(R223E, R224E)
Plasmid#84583PurposeExpresses GFP-tagged PH-domain of SWAP70 in mammalian cells, impaired phosphoinositide bindingDepositorInsertSWAP70 residues 209-306 with mutations R223E and R224E (SWAP70 Human)
TagsEGFPExpressionMammalianMutationPleckstrin-homology domain, residues 209-306, mut…PromoterCMVAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
shMYB-2
Plasmid#247031PurposeUsed for a knockdown of MYB in human Megakaryocyte/Erythroid ProgenitorsDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48A)-mCherry
Plasmid#193635PurposeExpresses S48A phosphodead VAMP3 fused to mCherryDepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationchanged serine 48 to alaninePromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48E)-mCherry
Plasmid#193637PurposeExpresses S48E phosphomimetic VAMP3 fused to mCherryDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
hVAMP3(1-77) WT
Plasmid#206028PurposeExpresses the SNARE motif of wildtype human VAMP3 in bacteriaDepositorInsertVesicle-associated membrane protein 3 (VAMP3 Human)
Tagshis-tagExpressionBacterialPromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
hVAMP3(1-77) S44A
Plasmid#206029PurposeExpresses the SNARE motif of human VAMP3 mutant S44A in bacteriaDepositorInsertVesicle-associated membrane protein 3 (VAMP3 Human)
Tagshis-tagExpressionBacterialMutationchanges serine 44 to alaninePromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only