We narrowed to 1,708 results for: CAG promoter
-
Plasmid#237555PurposeA piggybac-based vector containing mouse U6 promoter-driven RBBP6 sgRNA #6, human U6 promoter-driven RBBP6 sgRNA #8 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertRBBP6 (RBBP6 Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, human U6…Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 Nlgn3
Plasmid#59359PurposeLentiviral expression vector: Neuroligin 3 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorInsertsUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 Nlgn1
Plasmid#59339PurposeLentiviral expression vector: Neuroligin 1 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorInsertsUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgEIF3D-4
Plasmid#236766PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #4 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertEIF3D sgRNA-4 (EIF3D Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, CAG prom…Available SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgEIF3D-1
Plasmid#236765PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #1 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertEIF3D sgRNA-1 (EIF3D Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, CAG prom…Available SinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-dN40-TP53-CCRB
Plasmid#236774PurposeA piggybac-based cloning vector containing TRE3G promoter-driven short-form of TP53 and CAG promoter-driven nuclear-localized Clover-P2A-rtTA-IRES-BSD.DepositorInsertTP53 (TP53 Human)
UsePiggybacExpressionMammalianMutationdeleted amino acids 1-40PromoterTRE3G promoter and TRE3G promoter, CAG promoterAvailable SinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-TP53-CCRB
Plasmid#236773PurposeA piggybac-based cloning vector containing TRE3G promoter-driven full-length TP53 and CAG promoter-driven nuclear-localized Clover-P2A-rtTA-IRES-BSD.DepositorInsertTP53 (TP53 Human)
UsePiggybacExpressionMammalianPromoterTRE3G promoter and TRE3G promoter, CAG promoterAvailable SinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-GFP
Plasmid#28304PurposeCre-dependent AAV-mediated expression of GFP under the CAG promoterDepositorInsertGFP
UseAAV and Cre/Lox; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceJuly 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSil-ETN-ires-GFP
Plasmid#58831PurposeExpress ETN version of rabies virus glycoprotein and GFP from CAG promoterDepositorInsertETN version of Rabies glycoprotein external domain fused to normal Rabies glycoprotein cellular domain
Tagsires-EGFPExpressionMammalianPromoterCAGAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS31-cCARLIN
Plasmid#160928PurposeContains 10 constitutively expressed guide RNAs and CAG-GFP-CARLIN array sequence for DNA barcoding (when used in combination with Cas9)DepositorInsertCARLIN gRNAs and CAG-GFP-CARLIN array
UseMouse TargetingExpressionMammalianPromoterU6 promoter for gRNAs; CAG promoter for GFPAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Lari-BFP2-TSERex
Plasmid#123311PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertLari-BFP2
ExpressionMammalianPromoterCAGAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ArchT-BFP2-TSERex
Plasmid#123312PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertArchT-BFP2
ExpressionMammalianPromoterCAGAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CarO-BFP2-TSERex
Plasmid#124795PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertCarO-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Mac-BFP2-TSERex
Plasmid#124793PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertMac-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Char-BFP2-TSERex
Plasmid#124792PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertChar-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Nod-BFP2-TSERex
Plasmid#124785PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertNod-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato
Plasmid#28306PurposeCre-dependent AAV-mediated expression of tdTomato under the CAG promoterDepositorHas ServiceAAV PHP.S, AAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserttdTomato
UseAAV and Cre/Lox; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceSept. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJC49
Plasmid#133060PurposeLentiviral vector with a (Ubiquitous Chromatin Opening Element) UCOE upstream of a CAG promoter constitutively expressing a single insert containing the Tau.K18(P301L/V337M)-mScarlet-I fusion protein.DepositorInsertTau.K18(LM)
UseLentiviralTagsmScarletIExpressionMammalianPromoterCAGAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI H2B-RFP
Plasmid#92398PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), MCS and IRES controlled Histone2B-mRFP1 reporter.DepositorInsertIRES H2B RFP
ExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 p53
Plasmid#59360PurposeLentiviral expression vector: p53 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorInsertsUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAT009
Plasmid#171635PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting B2M and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-B2M
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCI H2B-GFP
Plasmid#92399PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), MCS and IRES controlled Histone2B-EGFP reporter.DepositorInsertIRES H2B EGFP
ExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAT007
Plasmid#171634PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting TRAC and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-TRAC
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH056
Plasmid#171637PurposePlasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-tdTomato
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT024
Plasmid#171636PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting BFP and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-BFP
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKC-Tol2
Plasmid#85600PurposeSource of Tol2 transposase driven by a mini-CAGS promoter.DepositorInsertTol2 transposase
ExpressionMammalianPromotermini-CAGAvailable SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAX-SCLM
Plasmid#216757PurposeFor strong and long-lasting expression of SuperClomeleon in mammalian cells from the hybrid CAG promoterDepositorInsertSuperClomeleon
ExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCAG (cytomegalovirus-chicken beta-actin-rabbit be…Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKTol2C-EGFP
Plasmid#85598PurposeTol2 transposon with EGFP driven by minimal-CAGs promoter.DepositorInsertTol2 transposon with EGFP
ExpressionMammalianPromotermini-CAGAvailable SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 Nlgn2
Plasmid#59358PurposeLentiviral expression vector: Neuroligin 2 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdx1-mTQ2-P2A-FlpO-PA
Plasmid#67279PurposePancreas specific expression of the FlpO recombinase controlled by the pdx1 promoter . FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertsmTQ2=mturquoise2 blue fluorescent gene
FlpO recombinase
Tagslinked to FlpO through an P2A ribosomal skipping …ExpressionMammalianPromoterpdxAvailable SinceJuly 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
enDelIscB
Plasmid#247329PurposeVector encoding human codon-optimized engineered DelIscB driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD770 Tet-On 3G in TUPV3
Plasmid#253883PurposeComponents for Integration Vectors: mMoClo TUPV, with CAG promoter and TetOn3GDepositorInsertTetOn3G
UseSynthetic BiologyExpressionMammalianPromoterCAGAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD847 Tet On 3G in TU2
Plasmid#253884PurposeComponents for Integration Vectors: mMoClo TUPV, with CAG promoter and TetOn3GDepositorInsertTetOn3G
UseSynthetic BiologyExpressionMammalianPromoterCAGAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
enIscB-T5E
Plasmid#205411PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fused with T5E at C-terminal driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_XTEN_T5E_npNLS_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD1411 Simple SV40 HBS
Plasmid#253894PurposeIntegration Vector for LumiScarlet with the HBS(SV40_min) promoter (TUPV1), and AkaLuc-P2A-mTagBFP2-P2A-BlastR with the CAG promoter (TUPV2)DepositorInsertLumiScarlet, AkaLuc-P2A-mTagBFP-P2A-BlastR
UseSynthetic BiologyExpressionMammalianPromoterHBS(SV40_min), CAGAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1413 Simple YBTATAHBS
Plasmid#253896PurposeIntegration Vector for LumiScarlet with the HBS(YB_TATA) promoter (TUPV1), and AkaLuc-P2A-mTagBFP2-P2A-BlastR with the CAG promoter (TUPV2)DepositorInsertLumiScarlet, AkaLuc-P2A-mTagBFP-P2A-BlastR
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA), CAGAvailable SinceApril 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
enDelIscB-T5E
Plasmid#247330PurposeVector encoding human codon-optimized engineered DelIscB fused with T5E at C-terminal driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB-T5E_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
EF1a-MCS-WPRE-SV40 - GCH13
Plasmid#230820PurposeAAV cloning vector for expression under the EF1a promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFAP-MCS-WPRE-SV40 - GCH31
Plasmid#230829PurposeAAV cloning vector for expression under the GFAP promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-MCS-WPRE-SV40 - GCH25
Plasmid#230826PurposeAAV cloning vector for expression under the TRE promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Syn-MCS-WPRE-SV40 - GCH7
Plasmid#230817PurposeAAV cloning vector for expression under the Syn promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-MCS-WPRE-SV40 - GCH19
Plasmid#230823PurposeAAV cloning vector for expression under the CaMKII promoter.DepositorTypeEmpty backboneUseAAV; Cloning vectorAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJT87
Plasmid#204489PurposeCAG promoted WBeta recombinaseDepositorInsertWBeta recombinase
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCAGAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT88
Plasmid#204490PurposeCAG promoted phiC31 recombinaseDepositorInsertphiC31 recombinase
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCAGAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only