We narrowed to 11,641 results for: nar;
-
Plasmid#62806PurposeTo express genes at high levels in neuronal cells. This UbC promoter is more active in neurons than the promoter in CMV-based vectors.DepositorTypeEmpty backboneUseAAV; EucaryoticExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pCR2.1 Clover-LMNA Donor
Plasmid#122508PurposeHomology repair template for in frame (first exon) clover knock-in of human LMNA geneDepositorInsertHomology Repair Template for Human LMNA (N-Terminal Clover Tag) (LMNA Human)
UseHomology repair template plasmid (donor plasmid)TagsCloverAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
2333_Cas9-CtIP-dnRNF168
Plasmid#200254PurposeThis plasmid expresses the Cas9-CtIP-dnRNF168 in mammalian cellsDepositorInsertCas9-CtIP-dnRNF168
ExpressionMammalianPromoterCMVAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Rainbow
Plasmid#206252PurposeExpression of 7 fluorescently labelled proteins in mammalian cells. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B (human); Actin, Tubulin (B. taurus); mito mCherry, GST mTagBFP1 (Synthetic); CyOFP1 (E. quadricolor); Ctnnb1 (mouse)
UseRecombinant baculovirus production (bac-to-bac)TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-TET1_CD
Plasmid#83570PurposeExpresses the catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deletedPromoterCMVAvailable SinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-ABE8e
Plasmid#206882PurposeExpresses FLAG-tagged ABE8e fused to Gag through a linker sequenceDepositorInsertABE8e
UseCRISPR and LentiviralTagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
ACE Reporter (pLenti-CMV-mCherry (+43) -T2A-eGFP)
Plasmid#109428PurposeA lentiviral backbone expressing mCherry with a 43 basepair insert and eGFP off of a CMV promoter. A reporter for both Cas9 nuclease and APOBEC-mediated base-editing activity.DepositorInsertmCherry T2A GFP
UseLentiviralMutationInserted 43 base pairs into mCherry to create rep…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
SlugCas9-HF
Plasmid#163796PurposeExpresses highly specific SlugCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianMutationSlugCas9 (R247A, N415A, T421A, R656A)Available SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
MultiMate 5 colors
Plasmid#206266PurposeExpression of 5 fluorescently labelled proteins in mammalian cells. Can be used as a CRE-donor (MultiBac system)DepositorInsertH2B (H. Sapiens), Actin and Tubulin (B. taurus), mito mCherry (Synthetic), CyOFP1 (E. quadricolor)
UseRecombinant baculovirus production, cre acceptor…ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1_CD
Plasmid#83571PurposeExpresses a mutant catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deleted, catalytic domain…PromoterCMVAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1
Plasmid#83569PurposeExpresses TET1 with a mutated catalytic domain in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianMutationcatalytic domain mutant H1672D, D1674APromoterCMVAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PEA1-GFP
Plasmid#171993PurposeDelivers all prime editing nickase components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICE-RNaseHI-WT-NLS-mCherry
Plasmid#60365PurposePlasmid for expression of bacterial RNase HI tagged with NLS-mCherry that can be used to degrade R-loops. Confers resistance to Puromycin. Expression is inducible in T-REx cells.DepositorInsertRNase HI
TagsNLS from SV40 T antigen and mCherryExpressionMammalianPromoterCMV-tetAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-BS-AtMIR390a-B/c
Plasmid#199559PurposeGATEWAY-compatible entry vectorDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseGateway-compatible entry vectorAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 N-T2A-M-IRES-E
Plasmid#231903PurposeFor the production of SARS-CoV-2 virus-like particles (VLPs) in the '3-plasmid' systemDepositorExpressionMammalianMutationR203M in N proteinPromoterCMVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide-PolB1-puro
Plasmid#177146PurposeLentiviral vector expressing PolB-gRNA-1 and a puromycin resistance cassetteDepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only