We narrowed to 16,166 results for: grna
-
Plasmid#131471PurposeCloning template form ORANGE method based knock-in constructsDepositorTypeEmpty backboneTagsHAExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT7EGFPgRNA
Plasmid#46760DepositorInsertegfp target
UseCRISPRPromoterT7Available sinceAug. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
Mouse CRISPRa sgRNA library Caprano in backbone XPR_502 (P65 HSF)
Pooled library#1000000113PurposeGenome-wide CRISPR gRNA pooled library for activation of mouse genesDepositorAvailable sinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Dlg4-GFP KI
Plasmid#131477PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)DepositorAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCasSA
Plasmid#98211PurposeCRISPR-based E. coli/Staphylococcus aureus temperature-sensitive plasmid for genome editing in Staphylococcus aureus using S. pyogenes Cas9DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px330-mcherry
Plasmid#98750PurposeCas9 from S.pyogenes with CMV-mcherry cassette, and cloning backbone for sgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKVL2-U6gRNA_SAM(BbsI)-PGKpuroBFP-W
Plasmid#112925PurposeLentiviral vector for SAM-CRISPRa gRNA expression with puroBFPDepositorInserthU6 promoter, gRNA-SAM expression cassette
UseCRISPR and LentiviralExpressionMammalianAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-(BbsI)_CBh-Cas9-T2A-mcherry-P2A-Ad4E4orf6
Plasmid#64222PurposeExpression vector for sgRNA and for Expression of Cas9 linked via T2A to mCherry linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherry-P2A-E4orf6ExpressionMammalianPromoterCBh and U6Available sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pdCas9-DNMT3A-EGFP (ANV)
Plasmid#71685PurposeExpression of mutant human codon-optimized dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-EGFP; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the inactivated (E756A) catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP (DNMT3A S. pyogenes, Human, Synthetic)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E756A inactiva…PromoterCBhAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s)
Plasmid#47868PurposeThis plasmid contains expression cassette for NmCas9 with N and C NLS and an HA tag, a cassette for expression of tracrRNA, a cassette for cloning crRNA under the control of U6 promoter.DepositorPublicationInsertsNmCas9
U6pr-tracrRNA
UseCRISPRTagsHA and NLSExpressionMammalianPromoterEF1a and U6Available sinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPRyl
Plasmid#70007PurposeCRISPR/Cas9 vector for Yarrowia lipolytica, with AvrII site for sgRNA insertionDepositorPublicationInsertsCodon optimized Cas9 from S. pyogenes
sgRNA expression cassette
UseCRISPR and Synthetic BiologyExpressionYeastPromoterSCR1'-tRNA and UAS1B8-TEF(136)Available sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSB700
Plasmid#64046PurposeLentiviral vector for expressing U6 sgRNA and CAGGS Cerulean fluorescent proteinDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterU6, CAGGSAvailable sinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAC152-dual-dCas9VP64-sgExpression
Plasmid#48238PurposeDual expression construct expressing both dCas9VP64 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA Tag, HA-Tag, and VP64ExpressionMammalianMutationD10A;H840AAvailable sinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pICSL01009::AtU6p
Plasmid#46968PurposeEncodes the Arabidopsis U6 promoter in a level 0 vector (Weber et al. PLoS One 6:e16765, 2011). It is used to place an sgRNA uder the Arabidopsis U6 promoter.DepositorInsertAtU6p
UseCRISPRExpressionPlantAvailable sinceAug. 15, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B
Plasmid#64218PurposeExpression vector for sgRNA and for Expression of Cas9 linked to BFP via T2A linked to Ad4 E1B via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E1BExpressionMammalianPromoterCBh and U6Available sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LRG2.1
Plasmid#108098PurposeLentiviral expression plasmid of sgRNA with GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available sinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6_gRNA_handle_U6t
Plasmid#49016PurposegRNA expression empty vector (mammalian cells)DepositorPublicationTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianAvailable sinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
scramble shRNA
Plasmid#1864Purpose3rd gen lentiviral negative control vector containing scrambled shRNADepositorInsertscramble
UseLentiviral and RNAiExpressionMammalianAvailable sinceApril 5, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by