We narrowed to 10,294 results for: otos
-
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-myc-LC3(G120A)-HA
Plasmid#45245DepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
TagsHA and mycExpressionMammalianMutationGlycine at position 120 mutated to AlanineAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_g5-HT3.0mut
Plasmid#208724PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0mut in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0mut
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSET-pr-mKikGR1 (mKikGR1-V69T)
Plasmid#99227PurposeBacterial expression of the primed conversion capable protein pr-mKikGR1 (mKikGR1-V69T).DepositorInsertpr-mKikGR1
ExpressionBacterialMutationmonomeric variant with mutation V69T (Eos notatio…PromoterT7Available SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEE062
Plasmid#176819PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert701
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-MAPTau-C-10
Plasmid#55431PurposeLocalization: Microtubules, Excitation: 433, Emission: 475DepositorAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-1
Plasmid#181870PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Cx32-7
Plasmid#54054PurposeLocalization: Gap Junctions, Excitation: 487, Emission: 509DepositorAvailable SinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
FusionRed-Dectin1A-C-10
Plasmid#56111PurposeLocalization: Membrane, Excitation: 580, Emission: 608DepositorAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEE077
Plasmid#176834PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert716
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-mApg5(K130R)
Plasmid#22959DepositorInsertautophagy related genes 5 (Atg5 Mouse)
TagsEGFPExpressionMammalianMutation130 Lysine to ArginineAvailable SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCDNAIIIB rac1 QL
Plasmid#61633Purposemammalian expression of rac1 constitutively active mutantDepositorAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-Mac-GFP
Plasmid#58852PurposeAAV-mediated expression of Mac-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) mannerDepositorInsertMac-GFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST JNKKTR AE Clover
Plasmid#90240PurposeLentiviral vector to express JNK KTR AE (mutant) mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (AE mutant)
UseLentiviralTagsmCloverExpressionMammalianPromoterPGKAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SFPQY527A
Plasmid#166961PurposeExpresses FLAG-tagged SFPQ Y527A protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
Neurod1-Atoh7HA3
Plasmid#44438DepositorInsertAtoh7-3xHA knock-in (Atoh7 Mouse)
UseCre/Lox and Mouse TargetingTagsNeurod1 left arm, Neurod1 right arm, and loxC2-Re…ExpressionMammalianAvailable SinceJuly 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET21c-His-Xa-Gluc-Xa-C9D-TGinsert
Plasmid#124660Purposereporter protein which emits bright blue fluorescenceDepositorInsertGaussia luciferase-C9D-TGinsert
TagsIEGRTMGDDDGDDDGDDD(FactorXa,TMG,C9D-Tag) and MHHH…ExpressionBacterialMutationchanged glutamic acid 100 to alanine, and glycine…PromoterT7 promoterAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_g5-HT2m
Plasmid#208722PurposeExpresses the green 5-HT sensor GRAB_g5-HT2m in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2m
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RNF8-N-terminus(1-111)
Plasmid#64671PurposeExpresses only N terminus of RNF8, amino acids 1 to 111DepositorInsertring finger protein 8 (RNF8 Human)
TagsGFPExpressionMammalianMutationcontaining only N-terminus amino acids 1 to 111PromoterCMVAvailable SinceMay 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabepuro3-p18
Plasmid#24935DepositorAvailable SinceJune 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#2
Plasmid#107727PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBAD mApple
Plasmid#91772PurposeBacterial expression of a fluorescent protein, monomeric Apple (mApple). Note: Addgene identified several mutations compared to the final published sequence.DepositorInsertmonomeric Apple
TagsHexa-Histidine tag, Xpress epitope for detection …ExpressionBacterialMutationR97K, E152S, A180S, V207T compared to mApple (FP …PromoteraraBADAvailable SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-tmeGFP-IRES-nls-mRuby2
Plasmid#63060PurposeExpresses truncated monomeric eGFP and nuclear localized mRuby2 (linked with IRES) in a Cre-dependent manner in an AAV backboneDepositorInsertnls-mRuby2
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
p10xUAS-IVS- Syn21-Voltron-p10
Plasmid#119041PurposeUAS-driven expresion of Voltron in DrosophilaDepositorInsertVoltron
ExpressionInsectPromoterhsp70Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RNF8-C-terminus
Plasmid#64673Purposeexpresses only C terminus of RNF8, amino acids 402-485DepositorInsertRing finger protein 8 (RNF8 Human)
TagsGFPExpressionMammalianMutationcontaining only C-terminus amino acids 402 to 485PromoterCMVAvailable SinceMay 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-myc-LC3(deltaC22)
Plasmid#45448DepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
TagsmycExpressionMammalianMutationEncodes amino acids 1-120Available SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFIN-XOPS-tdTOM-MOPS-GFP
Plasmid#44347DepositorInsertsXOPS-tdTOM
MOPS-GFP
UseLentiviralPromoterXenopus Opsin (XOPS) (pos 3131-4495) and mouse op…Available SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2VL-IRES-dOrai-IRES-mCherry
Plasmid#72898PurposeMammalian expression of dmBACCS2VL, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2VL-IRES-dOrai-IRES-mCherry
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
AfrLEA3m_mCh-2xFKBP (pBS1137)
Plasmid#185321PurposeFor the mammalian expression of the brine shrimp protein AfrLEA3m attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertAfrLEA3m
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only