We narrowed to 9,450 results for: tre promoter
-
Plasmid#118622Purposeexpression of mChe-tagged cdc42E7-E6-3'UTR under pSyn promoter for primary neuronsDepositorInsertcdc42E7-E6 3'UTR (Cdc42 Mouse)
UseLentiviralTagsmCherryExpressionMammalianMutationchanged ttgcttt to cggtaag (496 - 502 nt in 3…Promotersynapsin I (rat)Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆C-term_-3xFLAG
Plasmid#231936PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆C-term_3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of C-termPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆RNA3_-3xFLAG
Plasmid#231937PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆RNA3_3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of RNA3PromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-miniTurbo
Plasmid#231938PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207-miniTurboDepositorInsertZNF207 (ZNF207 Human)
TagsFLAG-miniTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆polar_-3xFLAG
Plasmid#231934PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆polar_3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutation∆polarPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆GLEBS_3xFLAG
Plasmid#231935PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆GLEBS_3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutation?GLEBSPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF_3xFLAG
Plasmid#247229PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-ZnF_3xFLAGDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-K42E_3xFLAG
Plasmid#247234PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-K42E_3xFLAGDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-K42M_3xFLAG
Plasmid#247235PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-K42M_3xFLAGDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-K42R_3xFLAG
Plasmid#247236PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-K42R_3xFLAGDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-GfaABC1D-Ezrin T567A-BioID2-HA
Plasmid#227683PurposeTo over express Phospho-dead Ezrin under gfaABC1D promoter in astrocytesDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NmClover3-hsLem2
Plasmid#179524PurposeExpress OsTIR1 and mClover3-mAID-hsLem2 in mammalian cells under the control of EF1a promoterDepositorAvailable SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-eGFP-Puro
Plasmid#79823PurposeExpresses human NEUROGENIN2 (hNGN2), eGFP and puromycin resistance gene under control of TetON promoter. This 3rd generation lentiviral vector is used to generate NGN2-iNs from hiPSCs and hiPSC-NPCs.DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC293 - pAAV EF1a V5-synuclein (WT)
Plasmid#60057PurposeAn AAV packaging vector that expresses wildtype alpha-synuclein under control of the EF1a promoter.DepositorAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Neo
Plasmid#99378PurposeExpresses human NEUROGENIN2 (hNGN2) and neomycin resistance gene under control of TetON promoter. 3rd generation lentiviral backbone.DepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK FKBP12(F36V)-OGT (Neo)
Plasmid#154294PurposeLentiviral vector encoding FKBP12(F36V)-2xHA-OGT (Neomycin resistant) off PGK promoterDepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x HA and FKBP12(F36V)ExpressionMammalianPromoterPGKAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.PAC
Plasmid#58329PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1a-hSNCA
Plasmid#170445PurposeLentiviral vector expressing human SNCA, under control of EF1alpha promoter.DepositorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1MUT-P2A-EGFP
Plasmid#176279PurposeViral vector for co-expression of non-functional Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1MUT-P2A-EGFP (Kcnj2 Mouse, Synthetic)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationGYG to AAA (aa144-146)Promoterhuman Synapsin IAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hMECP2-cycle3GFP
Plasmid#163706PurposepAAV plasmid for Cre-dependent expression of human MECP2 fused with cycle3 GFP under Syn promoterDepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Donor_ANKRD1_KO_Puro
Plasmid#186667PurposeDonor plasmid to endogenously knock out the ANKRD1 in Hek293 cells. eEF1a promoter, puromycin and polyA sequence is inserted between two homology arms.DepositorInsertANKRD1 KO Puromycin (ANKRD1 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CNTF-HA
Plasmid#195517PurposeExpresses HA-tagged CNTF in mammalian cellsDepositorInsertCiliary neurotrophic factor (CNTF Human)
UseAAVTagsHA-tag and NGF signal peptideExpressionMammalianPromoterUbC promoter with beta-globin intronAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mATP2B1
Plasmid#60789PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and mutated miR-155 sitesDepositorInsertATP2B1 3'UTR and mutated miR-155 binding site (ATP2B1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA K162M-mTurq2
Plasmid#157773PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
TagsmTurquoise2 and superYFPExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆ZnF_-3xFLAG
Plasmid#231930PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆ZnF_-3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of ZnFPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆Hel_-3xFLAG
Plasmid#231931PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆Hel_-3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of HelPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆QPG_-3xFLAG
Plasmid#231932PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆QPG_-3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of QPGPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207_∆RNA1-2_-3xFLAG
Plasmid#231933PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of ZNF207_∆RNA1-2_-3xFLAGDepositorInsertZNF207 (ZNF207 Human)
TagsFLAGExpressionMammalianMutationdeletion of RNA1-2PromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF+Hel_3xFLAG
Plasmid#247230PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-ZnF+Hel_3xFLAGDepositorInsertZNF207-ZnF+Hel (ZNF207 Human)
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF+Hel_K42E_3xFLAG
Plasmid#247231PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-ZnF+Hel_K42E_3xFLAGDepositorInsertZNF207-ZnF+Hel_K42E (ZNF207 Human)
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF+Hel_K42M_3xFLAG
Plasmid#247232PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-ZnF+Hel_K42M_3xFLAGDepositorInsertZNF207-ZnF+Hel_K42M (ZNF207 Human)
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-ZNF207-ZnF+Hel_K42R_3xFLAG
Plasmid#247233PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expresion of ZNF207-ZnF+Hel_K42R_3xFLAGDepositorInsertZNF207-ZnF+Hel_K42R (ZNF207 Human)
TagsFLAGExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
synapsin-hIRβ-mCherry
Plasmid#228449PurposeExpressing a truncated, constitutively active human insulin receptor (IRβ) with mCherry in rat primary hippocampal neuronsDepositorInserthuman Insulin Receptor beta subunit (INSR Human)
UseAAVPromoterneuron-specific synapsin promoteAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-ChloC
Plasmid#179841Purposedonor plasmid for cardiac-specific CCND2-T2A-Chloc expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagschloride-conducting ChR (ChloC)ExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro cTnT CCND2-T2A-iChloC
Plasmid#179842Purposedonor plasmid for cardiac-specific CCND2-T2A-iChloc expression in human cellsDepositorInsertCCND2 (CCND2 Human)
UseCRISPR and TALEN; Donor plasmidTagsimproved chloride-conducting ChR (iChloC)ExpressionMammalianPromoterTroponin T promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only