We narrowed to 10,104 results for: transfer
-
Plasmid#65453PurposeCan be used to generate AAV virus that will express EGFP from the tetO promoter under intersectional control by Flp and Cre recombinasesDepositorHas ServiceAAV1InsertEGFP
UseAAVPromotertetOAvailable SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-AlbEx14-mNG
Plasmid#201780Purposeknocks in mNeonGreen into exon 14 of Alb to produce Alb-mNeonGreen fusion protein in miceDepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAav-TP53-T2A-BirA*
Plasmid#115652PurposerAAV-based donor template for genome engineering of the TP53 protein C-terminus containing a T2A-BirA* module and a selection cassetteDepositorUseAAVTagsBirA* and T2AMutationHomology region 1 and Homology region 2Available SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC351 - pAAV CaMKIIa hChR2(H134R)-iRFP
Plasmid#47905PurposeAn AAV vector that expresses channel rhodopsin 2 (H134R) (fused to iRFP) under the CaM Kinase IIa promoter.DepositorInserthChR2(H134R)
UseAAVTagsiRFPExpressionMammalianMutationH134RPromoterCaMKIIaAvailable SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q52
Plasmid#111748PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ52 (polyQ repeat)PromoterCMV and P10Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q24
Plasmid#111742PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ24 (polyQ repeat)PromoterCMV and P10Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CDreV
Plasmid#140133Purposecan be used to generate AAV virus that will express fusion protein of split Dre (C-terminal) and fungal photoreceptor Vivid (VVD) monomerDepositorInsertCDreV
UseAAVPromoterEF1aAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hsChRmine-eYFP-WPRE
Plasmid#183530PurposeOptogeneticsDepositorInserthsChRmine-eYFP
UseAAVMutationH33RPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2A-ΔC-S227A
Plasmid#200560PurposeSecreted mouse CES2A S227A mutant driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2A S227A mutant delta C-terminal (Ces2a Mouse)
UseAAVTagsFlagPromoterCMV promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.CD86.C-HA
Plasmid#154848PurposeExpresses murine CD86 protein (T-lymphocyte activation antigen) with HA-tag at C-terminusDepositorInsertCluster of Differentiation 86 (Cd86 Mouse)
UseAAVTagsHA-tagExpressionMammalianPromoterCMVAvailable SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184V
Plasmid#106190PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterCAGAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
miR5 Mm ATP13A2
Plasmid#171822Purposetransfer plasmid for lentiviral vector production with miR for Mm ATP13A2DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
miR3 Mm ATP13A2
Plasmid#171771Purposetransfer plasmid for lentiviral vector production with miR for Mm ATP13A2DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC710 - pAAV EF1a DIO Mem-AcGFP
Plasmid#75081PurposeAn AAV packaging vector that expresses Cre-dependent membrane-localized AcGFP under control of the EF1a promoter.DepositorInsertMem-AcGFP
UseAAV and Cre/LoxTagsPalmitylation siteExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-DNMT3A-L-N-spC9-N-intein-hGH
Plasmid#112212PurposeTargeted DNA methylationDepositorAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-S1-jRCaMP1a
Plasmid#160728PurposeSignaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains RFP-based fluorescent reporter jRCaMP1a (calcium indicator), Xpress tag, and S1 protein scaffold.DepositorInsertS1-jRCaMP1a
UseAAVExpressionMammalianMutationN/APromoterHuman ubiquitin C (UBC) promoterAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.SV40.THBS1-deltaTSR3-CTD-HA.SV40(polyA)
Plasmid#155194PurposeExpresses truncated (AA 1-690) murine Thrombospondin-1 (THBS1) protein with HA-tag at C-terminusDepositorInsertThrombospondin-1 (Thbs1 Mouse)
UseAAVTagsHA-tagExpressionMammalianMutationTruncated sequence of THBS1 (expresses Amino Acid…PromoterCMVAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-SomArchon-mTagBFP2-p2A-CoChR-Kv2.1
Plasmid#206006PurposeExpression of SomArchon-mTagBFP2 and CoChR under Syn promoterDepositorInsertSomArchon-mTagBFP2-P2A-CoChR-Kv2.1
UseAAVTagsmTagBFP2ExpressionMammalianPromoterhSynAvailable SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.SF-Venus-iGluSnFR.S72A
Plasmid#106179PurposeWeak affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.S72A
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: S72APromoterhSynapsinAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97310PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb NHEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [ChrimsonR-GFP]
Plasmid#118295PurposeAAV-mediated expression of ChrimsonR-GFP under the CAG promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterCAGAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAav-MDM2-PQS2-3xHA
Plasmid#84886PurposerAAV-based template for genome engineering of the MDM2 protein C-terminus containing PQS2 and 3xHA tags and a selection cassetteDepositorUseAAVTagsPQS2 3xHAPromoternoAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-GFP
Plasmid#122098PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-ChR2-YFP
Plasmid#178725PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES G418
Plasmid#110344Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Geneticin selection.DepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterCMVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBacMam2-DiEx-LIC-C-flag_huntingtin_full-length_Q25
Plasmid#111743PurposeBaculovirus transfer vector for expression of huntingtin protein in insect and mammalian cellscells as well as in mammalian cellsDepositorInsertHTT (HTT Human)
UseBaculovirus expressionTagsFLAGExpressionMammalianMutationQ25 (polyQ repeat)PromoterCMV and P10Available SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.S72A
Plasmid#106185PurposeWeak affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1InsertSF-Venus-iGluSnFR.S72A
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: S72APromoterhSynapsinAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.S72A
Plasmid#106191PurposeWeak affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.S72A
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: S72APromoterCAGAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only