We narrowed to 15,163 results for: GRN
-
Plasmid#135740PurposeEncodes gRNA for 3' target of human ZNF331DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PX458_CEBPG_2
Plasmid#86345PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Control-Control-LRG-GFP
Plasmid#225873PurposeTwo copies of guide RNA targeting a control sequenceDepositorInsertControl
UseCRISPR and LentiviralAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR v2-sgNCKAP1-2
Plasmid#210134Purposeknock out NCKAP1 in mammalian cellsDepositorInsertNck-associated protein 1 (NCKAP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_human_ADAR2_ccC
Plasmid#158112Purposedeletion hADAR2DepositorInsertADAR2 (ADARB1 Human)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_human_ADAR2_ccA
Plasmid#158114Purposedeletion hADAR2DepositorInsertADAR2 (ADARB1 Human)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-AtpU6-26
Plasmid#160218PurposeAtpU6-26 Golden Gate level 0 piece to express gRNAsDepositorInsertpAtU6-26 promoter
UseGolden gate level 0 piece to express grnasAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTX1-SMN1-exon7-ESE1
Plasmid#126041PurposeIn-vitro-transcription of SMN1-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN1 exon7 ESE1
Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone3
Plasmid#162130PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPU-huTRIMmiR30-L1221
Plasmid#132937PurposeAll-in-one huTRIM5 rescue-control shRNA knockdownDepositorInserthuman TRIM5
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJin-278
Plasmid#125714PurposeABA-inducible split T7 GFP vector using RNAPN d5-19DepositorInsertPT7-GFP mRNA expression, PYL-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-ABI
ExpressionMammalianAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISP_IS
Plasmid#120425PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3 and IS5.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shNFS1_2
Plasmid#102964PurposeSuppression of NFS1DepositorInsertshNFS1_2 (NFS1 Human)
UseLentiviral and RNAiAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN098
Plasmid#91625PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN099
Plasmid#91626PurposeExpress sgRNA targeting human HCN1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN007
Plasmid#91575PurposeExpress sgRNA targeting human BCL11ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Template ORF0
Plasmid#240304PurposeDonor:smFP-V5 KO:TemplateDepositorInsertTemplate gRNA
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJMP8823
Plasmid#220901PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (mscar targeting), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8835
Plasmid#220902PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (mscar targeting), and PG-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8923
Plasmid#220904PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (BsaI site), and PG-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8930
Plasmid#220905PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PC-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1 KO
Plasmid#218182PurposeTo KO Hevin in astrocytesDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.3#3/Cre
Plasmid#173662PurposeExpresses a NT.3-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE386
Plasmid#149284PurposeT-DNA encoding TRV2 with gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-Gsk3b(new)
Plasmid#122341PurposeExpresses sgRNA targeting mouse Gsk3b and eSpCas9 in mammalian cellsDepositorInsertsgRNA for mouse Gsk3b
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
PX458_MBD1_iso1_1
Plasmid#86303PurposeEncodes gRNA for 3' target of human MBD1_iso1DepositorInsertgRNA against MBD1_iso1 (MBD1 Human)
UseCRISPRAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NR2F6_2
Plasmid#86343PurposeEncodes gRNA for 3' target of human NR2F6DepositorInsertgRNA against NR2F6 (NR2F6 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NR2F6_1
Plasmid#86342PurposeEncodes gRNA for 3' target of human NR2F6DepositorInsertgRNA against NR2F6 (NR2F6 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSJX023
Plasmid#232326PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and sfGFPExpressionBacterialPromoterPJ23119 and PxylAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-USP7-sh1
Plasmid#235527PurposeshRNA against human USP7DepositorInsertUSP7 (USP7 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-USP7-sh5
Plasmid#235528PurposeshRNA against human USP7DepositorInsertUSP7 (USP7 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJX024
Plasmid#232327PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialPromoterPJ23119 and PxylAvailable SinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-Vector
Plasmid#171194PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shRNA (to be used in conjunction with Phoenix packaging cells).DepositorInsertshRNA empty vector
UseRetroviralExpressionMammalianPromoterU6Available SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-CasRx-pa
Plasmid#233035PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pHS1929
Plasmid#205968PurposeJAGBLH010000220 Cas8-HNH crRNA expression in pCOLADuet-1DepositorInsertCas8-HNH crRNA
ExpressionBacterialPromoterT7Available SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT450
Plasmid#139390PurposeBile Acid inducible sgRNA-3 with PM3 driving Nanoluc expression (NOT Gate 3), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-3 with PM3 driving Nanoluc expression (NOT Gate 3), pNBU1 backbone, AmpR, ErmR
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable SinceJan. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_Hygro_mini-mAgrin-Myc-His
Plasmid#198130PurposeExpress mini-Agrin in mammalian cellsDepositorAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYZ714
Plasmid#132955PurposecrRNA entry vector of Pfba1-BsaI pad-TEF1 Term with dFnCas12a-Clr4 in Schizosaccharomyces pombeDepositorInsertdFnCas12a
UseCRISPR and Synthetic BiologyTagsSV40 NLS and nucleoplasmin NLSPromoteradh1Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgMark2-mU6-sgMark3-hU6-sgMark4
Plasmid#177235PurposeExpresses Mark2 (bU6), Mark3 (mU6) and Mark4 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgMark2/sgMark3/sgMark4
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
THI VP64 pALD4 T-
Plasmid#161481PurposeNon targeting control for CRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_only_SV40NLS_pALD4_THi11_T-_gRNA_MS2DepositorInsertsdCAS9
MS2-VP64
gRNA (Non targeting control NTC)
ExpressionYeastPromoterpALD4, pPOR1, and pTEF2Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone1
Plasmid#162122PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only