We narrowed to 10,020 results for: CAG
-
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with 8 bp bulge loops (GAPDH)
Plasmid#170121PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with 8bp bulge loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
csr-1_qa-2_dsimpα_bar
Plasmid#251402PurposeEnables inducible expression of double-stranded RNA targeting importin α (NCU01249) under the control of the qa-2 promoter, with the expression cassette inserted at the csr-1 locus.DepositorInsertimportin alpha
UseRNAiAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (SMAD4)
Plasmid#180191PurposeAAV vector carrying a guide RNA targeting the human SMAD4 mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops
UseAAVExpressionMammalianPromoterHuman U6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7534 pHR (hU6-crSURF1-EFS-PuroR-WPRE)
Plasmid#214878PurposeLentiviral vector encoding RfxCas13d targeting SURF1 guide arrayDepositorInserthU6-crSURF1-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239030PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Plxnd1 sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239032PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ClipF-HA-2a-Hu VGAT sesRNA-2a-smV5-2a-tTA2-WPRE
Plasmid#239031PurposeExpression of ClipF, sesRNA in mammalian cells, with smV5 and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Circular 100,50 (RAB7A)
Plasmid#170117PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorInsertCircular 100,50 guide RNA
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7529 pHR (hU6-crLPT-EFS-PuroR-WPRE)
Plasmid#214877PurposeLentiviral vector encoding RfxCas13d targeting LPT guide arrayDepositorInserthU6-crLPT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-pcr4
Plasmid#193662PurposeExpression of tandem pre-sgRNA array pcr4 for LbCas12aDepositorInsertU6-PUM1-sgRNA-GHR-sgRNA-HMGA2-sgRNA-PUM2-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode17
Plasmid#226190PurposeExpression mappingDepositorInsertSyn Barcode17
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCM-AAVS1-TO-hNGN2
Plasmid#105840PurposeDonor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuronDepositorInsertsUseCRISPR and TALENPromoterCAG, EF-1alpha, and TRE3GAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCE-mp53DD
Plasmid#41856PurposeNon-integrating (episomal) expression of mouse p53DD - p53 carboxy-terminal dominant-negative fragmentDepositorAvailable SinceJuly 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-ZIM3-KRAB-dCas9-P2A-mCherry
Plasmid#212829PurposeDoxycycline-inducible (Zim3)KRAB-dCas9-HA-P2A-mCherry cassette for integration at the AAVS1-locus of the human genome.DepositorInsertZIM3-KRAB-dCas9-P2A-mCherry
TagsHA-tag and ZIM3-KRABExpressionBacterial and MammalianPromoterCAG, TetOnAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only