We narrowed to 11,250 results for: streptococcus -(crispr) -(cas9)
-
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNA0304
Plasmid#165612PurposeVector for expression of sgRNAs in yeast: SNR52p-NotI-sgRNA-SUP4t (NotI site in place of the spacer)DepositorInsertSNR52p-NotI-sgRNA-SUP4t (S. cerevisiae SNR52 promoter driving the sgRNA for SpCas9, with a NotI site in place of the spacer)
UseCRISPRExpressionYeastMutationNotI site replaced the CAN1 spacer in parent vect…PromoterSNR52Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307_ms2_VP64
Plasmid#79375PurposeRecruits VP64 to compatible gRNAs for transcriptional activationDepositorInsertms2-VP64
UseCRISPRExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgUFM1
Plasmid#86133PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UFM1DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAct:dCas9-scFv
Plasmid#78900PurposeExpresses scFv-VP64 under actin promoter for SunTag CRISPRa in Drosophila cellsDepositorInsertscFV-VP64
UseCRISPRTagsGFPExpressionInsectPromoterpActin (Drosophila)Available SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pLAT1_Cas9
Plasmid#104908PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
AXL gRNA (BRDN0001146797)
Plasmid#76700Purpose3rd generation lentiviral gRNA plasmid targeting human AXLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-dCas9-Zim3-MeCP2
Plasmid#220143Purposedoxycycline-inducible dCas9-Zim3-MeCP2 expression for Epigenetic repressionDepositorInsertdCas9-Zim3-MeCP2
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterTre-3GAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Arpc5 KI
Plasmid#131503PurposeEndogenous tagging of Arp2/3 complex subunit 5: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA(lib)-puro
Plasmid#119976PurposeLenti sgRNA cloning backbone with CMV-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CR102
Plasmid#234043Purposeexpresses ABE8e(V106W) - SpG Cas9 base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertTadA8e(V106W)-SpG-Cas9(D10A)-P2A-blast
UseLentiviralAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hCas9D10A
Plasmid#52101PurposeThe expression vector for humanized nickase Cas9 (Cas9D10A) under CAG promoterDepositorInserthCas9D10A
TagsSV40 NLSExpressionMammalianMutationD10APromoterCAGAvailable SinceApril 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_UQCRC2
Plasmid#177982Purposelentiviral vector expressing Cas9 and a sgRNA targeting UQCRC2DepositorInsertsgRNA targeting UQCRC2 (UQCRC2 Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
GS2.1/EC
Plasmid#132568PurposesgRNA targeting A. thaliana pds3, regulated by A. thaliana U6 polIII promoter. Cas9 with a C-terminal mApple fusion, egg cell-specific expression. Hygromycin selectable marker (hpt).DepositorInsertegg cell promoter, Cas9-mApple, pds3 sgRNA
UseCRISPR and Synthetic BiologyExpressionPlantPromoterA. thaliana egg cell promoterAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBHM2406
Plasmid#173442PurposepRS316-mNeonGreen-CBP-2XFLAG-HYGB, contains C. neoformans optimized mNeonGreen and HYG marker for use as PCR templateDepositorInsertmNeonGreen-CBP-2XFLAG-HYGB
TagsCBP-2xFLAGExpressionBacterial and YeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only