We narrowed to 22,317 results for: ENA
-
Plasmid#110843PurposeLentiviral vector for constitutive expression of BE3RA in mammalian cells (codon optimized)DepositorInsertBE3RA
UseLentiviralMutationD10APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
PA-mCherry1-ER-5
Plasmid#57174PurposeLocalization: Endoplasmic Reticulum, Excitation: 400 / 504, Emission: 515 / 517DepositorInsertER (CALR Human)
TagsPA-mCherry1ExpressionMammalianMutationER Signal PeptidePromoterCMVAvailable SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-B103 (LM2907)
Plasmid#208968PurposeUnfused B103 DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertB103-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianPromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g1)-PGKpuroBFP-W
Plasmid#105037PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g2)-PGKpuroBFP-W
Plasmid#105038PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2VL-IRES-dOrai-IRES-mCherry
Plasmid#72898PurposeMammalian expression of dmBACCS2VL, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2VL-IRES-dOrai-IRES-mCherry
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-VprBP (C590)
Plasmid#133589PurposeExpresses human VprBP C590 mutant in mammalian cellsDepositorInsertVpr (HIV-1) binding protein (DCAF1 Human)
TagsHAExpressionMammalianMutationC590 mutation of human VprBP lacking the N-terminā¦Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-flk1-cytoBirA-2A-mCherry_Ras
Plasmid#80056PurposeFlk1/Kdrl promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterflk1Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
MDH1-miR-31SM-PGK-GFP-Blast
Plasmid#31516DepositorInsertmiR-31 (Mir31 Mouse)
UseRetroviralTagsGFPExpressionMammalianMutationseed mutant controlAvailable SinceSept. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2NS-IRES-dOrai-IRES-mCherry
Plasmid#72896PurposeMammalian expression of dmBACCS2NS, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2NS-IRES-dOrai-IRES-mCherry
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_HSP7C
Plasmid#111667PurposeMAC-tagged gene expressionDepositorInsertHSP7C (HSPA8 Human)
ExpressionMammalianAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-138-5p
Plasmid#103233PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-138-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-138-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
mVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax
Plasmid#173866PurposeMammalian expression of mVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax (opto-Cdc42)DepositorInsertmVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax
TagsC-terminal CAAX-box and mVenusExpressionMammalianPromoterCMVAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGW045 AAV-CRISPRa base vector pAAV_OE-U6sgbbSapI(MS2)-EF1a-MPH-WPRE
Plasmid#192161PurposeAAV-CRISPRa base vectorDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_CDK7
Plasmid#111684PurposeMAC-tagged gene expressionDepositorInsertCDK7 (CDK7 Human)
ExpressionMammalianAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
PET28-FnCas12a-EP16
Plasmid#183636PurposePET28-FnCas12a-EP16 can efficiently recognize a broad range of PAM sequences including YN (Y = C or T), TAC and CAA.DepositorInsertFnCas12a-EP16
UseCRISPRTags6ĆHis TagExpressionBacterialMutationN607R, K613V, N617R, K180S, K660R, D616NAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-19b-3p
Plasmid#103327PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-19b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-19b-3p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
P1_Firre_1.49_pDONR221
Plasmid#195204PurposePlasmid with pDONR221 backbone containing Firre 1.49 clone. Kanamycin resistance. Gateway cloning system.DepositorInsertmFirre 1.49 Clone
UseGateway cloning intermediateMutationOnly exonsAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pegAAT K342E correction
Plasmid#169841PurposeExpress a pegRNA used for correction (via Aā¢T-to-Gā¢C) of the E342K mutationDepositorInsertpegAAT K342E correction (SERPINA1 Human)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-BICDR1
Plasmid#111859PurposeFull length BICDR1 for expression in Sf9 cells. 8xHis-ZZ N-terminal tag, TEV site to cleave 8x-His-ZZ.DepositorAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBC2T-Ypet-FtnA
Plasmid#108969Purposeexpresses BC2-tag-Ypet-FtnA in mammalian cellsDepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-VprBP (RARA)
Plasmid#133587PurposeExpresses human VprBP RARA mutant in mammalian cellsDepositorInsertVpr (HIV-1) binding protein (DCAF1 Human)
TagsHAExpressionMammalianMutationRARA mutation of human VprBP defective in DDB1 biā¦Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPKm-245
Plasmid#90503PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
8xCTS1_WT-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_WT-hutRNApro_SV40polyA
Plasmid#124541PurposeCloning vector for tRNA-released synergistic activation mediator gRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertWT-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_WT-hutRNApro
ExpressionMammalianMutationWT, WTPromoterMinimal ADEAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5ā²-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPKm-244
Plasmid#90502PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - IRES - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-GFP-RELA K5R
Plasmid#196631PurposeExpress GFP-RELA K5RDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-VIM-BC2T
Plasmid#108966Purposeexpresses mCherry-vimentin-BC2-tag in mammalian cellsDepositorAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGW05 AAV-CRISPRa base vector pAAV-OE_U6-Lib(MS2)-EF1a-MPH-sPA
Plasmid#192159PurposeAAV-CRISPRa base vectorDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
8xCTS1_deltaC55A-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_delta-hutRNApro_SV40polyA
Plasmid#124539PurposeCloning vector for tRNA-released synergistic activation mediator gRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertdeltaC55A-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_delta-hutRNApro
ExpressionMammalianMutationd11-41 C55A, d11-41PromoterMinimal ADEAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPKm-112
Plasmid#90494PurposepcDNA3 - pCMV - MTAD - PIF3, expresses Phytochrome interacting factor 3 (PIF3) and minimal transactivation domain (MTAD), under CMV promoterDepositorInsertMTAD-PIF3
ExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CS-154
Plasmid#166230Purposelenti-U6-gRNA::CMVp-nCas9-PmCDA1-UGI-2A-mCherryDepositorInsertsU6-gRNA EGFP targetting
nCas9-PmCDA1-UGI-2A-mCherry
UseCRISPR and LentiviralPromoterCMV promoter and Human U6Available SinceDec. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-133a-3p
Plasmid#103221PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-133a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-133a-3p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pChlr-8SE
Plasmid#52172PurposeEncodes module 8 with amino acids 12S-16E for recognition of nt 1GDepositorInsertPumilio homology domain amino acids 284-319 (PUM1 Human)
ExpressionBacterialMutationChanged 12N to 12S and 16Q to 16E in module 8Available SinceApril 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pChlr-4SYR
Plasmid#52158PurposeEncodes module 4 with amino acids 12S-13Y-16R for recognition of nt 5CDepositorInsertPumilio homology domain amino acids 133-168 (PUM1 Human)
ExpressionBacterialMutationChanged 12N to 12S, 13H to 13Y, and 16Q to 16R inā¦Available SinceApril 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pChlr-5SR
Plasmid#52162PurposeEncodes module 5 with amino acids 12S-16R for recognition of nt 4CDepositorInsertPumilio homology domain amino acids 169-204 (PUM1 Human)
ExpressionBacterialMutationChanged 12C to 12S and 16Q to 16R in Module 5Available SinceApril 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pChlr-6SE
Plasmid#52164PurposeEncodes module 6 with amino acids 12S-16E for recognition of nt 3GDepositorInsertPumilio homology domain amino acids 205-240 (PUM1 Human)
ExpressionBacterialMutationChanged 12N to 12S and 16Q to 16E in Module 6Available SinceApril 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
mVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax
Plasmid#173865PurposeMammalian expression of mVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax (opto-Rac1)DepositorInsertmVenus-NES-SspB-Tiam-DHPH-P2A-iLIDcaax
TagsC-terminal CAAX-box and mVenusExpressionMammalianPromoterCMVAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-26a-5p
Plasmid#103379PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-26a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-26a-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2VL-IRES-dOrai-IRES-GFP
Plasmid#72897PurposeMammalian expression of dmBACCS2VL, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and GFPDepositorInsertdmBACCS2VL-IRES-dOrai-IRES-GFP
TagsIRES-GFPExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGY466
Plasmid#166661PurposeFor light-inducible Cre recombinase (LiCre) expression under the Met17 promoter in yeastDepositorInsertLiCre
UseCre/LoxExpressionYeastMutationCre: E340A, D341APromoterMET17Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-125b-5p
Plasmid#103191PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-125b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-125b-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
Sox2-SE-RGM-eGFP targeting vector
Plasmid#133045PurposeTargeting vector of RGM-eGFP with homologous arms around Sox2 super-enhancer DMRDepositorInsertSox2-SE-5arm-RGM-Sox2-SE-3arm
UseMouse TargetingAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-101-5p
Plasmid#103166PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-101-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-101-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-7-1-3p
Plasmid#103722PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-7-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-7-1-3p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pChlr-4SE
Plasmid#52152PurposeEncodes module 4 with amino acids 12S-16E for recognition of nt 5GDepositorInsertPumilio homology domain amino acids 133-168 (PUM1 Human)
ExpressionBacterialMutationChanged 12N to 12S and 16Q to 16E in Module 4Available SinceMay 23, 2014AvailabilityAcademic Institutions and Nonprofits only