We narrowed to 1,708 results for: CAG promoter
-
Plasmid#62685PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP419/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATK (pKD-G9)
Plasmid#62688PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#173211PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 sgRNA + MTOR Nick exon-53 sgRNA
UseCRISPR; Prime editing (pe3)ExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA
Plasmid#173212PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +4 T to G pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-CMVp-mito-mTFP1
Plasmid#182378PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterCMV promoter and SV40 promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry
Plasmid#182379PurposeDual expression construct encoding shRNA-resistant mtIF3 and mCherry from separate promotersDepositorInsertsTags3xFlagExpressionMammalianMutationChanged CDS sequence from 'ccacgttcaagtcacga…PromoterHSV TK promoter and SV40 promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-HLP-SACas9-HA-OLLAS-spA
Plasmid#206860PurposeAn AAV plasmid with U6 promoter driving a gRNA against LDLR and liver specific HLP promoter driving SaCas9DepositorInsertmLdlr gRNA (Ldlr Mouse)
UseAAV and CRISPRAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330_SAFB2gRNA12
Plasmid#196106PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_RUNX1_+1_ATGins_Dual_pegRNA
Plasmid#173213PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 and RUNX1 +1 ATG insertion pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + RUNX1 +1 ATG insertion pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC-tracrRNA-PMtU6-26
Plasmid#209191PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-26 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-tracrRNA-PMtU6-1
Plasmid#209190PurposeCloning of sgRNAs for expression in plantsDepositorInsertMtU6-1 SnRNA promoter
UseCloning vectorAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-2)-PGKpuro2ABFP-W
Plasmid#252916PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR1-1)-PGKpuro2ABFP-W
Plasmid#252915PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U3
Plasmid#173156PurposeSingle guide RNA cassette under U3 promoterDepositorInsertsgRNA cassette under U3 promoter
ExpressionPlantPromoterpromoter region of the U3C snRNA gene (Marshallsa…Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmIL-6 mut C/EBP
Plasmid#61291Purposedrives luciferase from mouse IL-6 promoter with mutant C/EBP (NF-IL-6) siteDepositorInsertIL-6 promoter (Il6 Mouse)
UseLuciferaseExpressionMammalianMutationMutated C/EBP binding site from ACATTGTGCAATCT to…PromoterIL-6 promoter with mutant C/EBP binding siteAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
WPXL SOX10 gRNA
Plasmid#101923PurposeSOX10 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertSOX10 promoter targeting gRNA
UseLentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(sgCXCR2-2)-PGKpuro2ABFP-W
Plasmid#252918PurposeExpression vector for gRNA with Puro and tagBFP selection markersDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdc20
Plasmid#160954PurposeCdc20 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA4
Plasmid#136459PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV_RHOT1 sgRNA_dCas9-KRAB-T2A-EGFP
Plasmid#253810PurposeExpress RHOT1 sgRNA under U6 promoter and dCas9-KRAB-T2A-EGFP under hUbC promoterDepositorInsertsgRNA RHOT1 (RHOT1 Human)
UseCRISPR and LentiviralExpressionMammalianPromotersgRNA for U6p and dCas9-KRAB-T2A-GFP for hUbCpAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRho-DsRed
Plasmid#11156DepositorAvailable SinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCabp5-DsRed
Plasmid#11157DepositorAvailable SinceApril 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-T_RFP entry
Plasmid#87526PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-A_RFP entry
Plasmid#87527PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-C_RFP entry
Plasmid#87528PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTALE-STAR-G_RFP entry
Plasmid#87529PurposeDestination vector for domain insertionDepositorTypeEmpty backboneUseSynthetic Biology and TALEN; Tale empty functiona…Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -hKCNJ2
Plasmid#246998PurposeCan be used to generate AAV virus that will express human KCNJ2 from EF1α core promoterDepositorAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
Cd99l2 long
Plasmid#74469PurposeExpresses Cd99l2 transcript variant 1-IRES-EGFP under CAG promoter in mammalian cellsDepositorInsertCD99 antigen-like 2, transcript variant 1 (Cd99l2 Mouse)
ExpressionMammalianPromoterchicken beta actin promoterAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cd99l2 short
Plasmid#74470PurposeExpresses Cd99l2 transcript variant 2-IRES-EGFP under CAG promoter in mammalian cellsDepositorInsertCD99 antigen-like 2, transcript variant 2 (Cd99l2 Mouse)
ExpressionMammalianPromoterchicken beta actin promoterAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgCTRL-puro
Plasmid#199634PurposesgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CA-rtTA Adv
Plasmid#20910PurposepiggyBac vector for expression of reverse tetracycline transactivator from a CAG constitutive promoterDepositorInsertrtTA-ON-Adv
UsepiggybacExpressionMammalianAvailable SinceApril 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tTA
Plasmid#149363PurposeAAV-mediated and Cre-dependent expression of tTA under the CAG promoter.DepositorInserttTA2
UseAAV and Cre/LoxExpressionMammalianAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCA-G-intron-G
Plasmid#40027DepositorInsertsGFP exon 1
GFP exon 2
beta-globin intron
ExpressionMammalianMutationinsertion of a loxP site, nucleotides 1-274, and …PromoterCAG (chicken beta globin promoter and CMV enhance…Available SinceOct. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAYC
Plasmid#62657PurposeMammalian expression of iCre recombinase from the broadly active CAG promoter/enhancerDepositorInsertiCre
ExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCA-T-intron-G
Plasmid#36887DepositorInsertsT (i.e., ATG, start codon as a first exon)
GFP
beta-globin intron
ExpressionMammalianMutationdeleted nucleotides before nucleotide 275 and ins…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBCV
Plasmid#62659PurposeMammalian expression of FLPo recombinase from the broadly active CAG promoter/enhancerDepositorInsertFLPo
ExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCA-G-intron-T
Plasmid#36885DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA-ATG-intron-tdT3Myc
Plasmid#36883DepositorInserttdTomato-3Myc
Tags3 Myc tagsExpressionMammalianMutationbeta-globin intron containing a loxP site inserte…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJM465 EF1α 3xFLAG-NLS-VP64-ZF1 in TUPV2
Plasmid#161533PurposeConstitutive expression of 3xFLAG-NLS-VP64-ZF1 under the EF1α promoterDepositorInsert3xFLAG-NLS-VP64-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT234_(pCA-G-intron-tTA2)
Plasmid#36874DepositorInsertsGFP
tTA2
beta-globin intron
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
APX1-pm-mKate2
Plasmid#245521PurposePlasmid for PiggyBac /ITR mediated insertion of pm-mKate2 sequence downstream of CAG promoter using Gateway recombination cassetteDepositorInsertpm-mKate2
ExpressionMammalianAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only