We narrowed to 7,159 results for: GFP expression plasmids
-
Plasmid#177426PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with L61G mutation in BH3 domain to disrupt binding anti-apoptotic proteins. Mutation made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationLeucine 61 replaced with glycinePromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-GG153AA-pEGFP-C1
Plasmid#177427PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with G153A,G154A mutations in membrane binding region. Mutations made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationGlycines 153 and 154 mutated to alaninePromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-G154STOP-pEGFP-C1
Plasmid#177428PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, truncatated within the membrane binding region (1-154). Stop codon added to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationGlycine 154 replaced with STOP codonPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
CpxR-GFP
Plasmid#220150PurposeTo track the natural CpxR promoter's transcriptional dynamicsDepositorInsertCpxR promoter only
ExpressionBacterialAvailable SinceAug. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL3-GFP
Plasmid#67397PurposeMammalian expression of hArl3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL8B-GFP
Plasmid#67404PurposeMammalian expression of hArl8b with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-SARA-GFP
Plasmid#67410PurposeMammalian expression of hSara with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF6-GFP
Plasmid#67394PurposeMammalian expression of hArf6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL1-GFP
Plasmid#67395PurposeMammalian expression of hArl1 with C-term GFP tagDepositorInsertARL1 (ARL1 Human)
TagsGFPExpressionMammalianMutationbp 231 C to T; silent mutationPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL6-GFP
Plasmid#67401PurposeMammalian expression of hArl6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL14-GFP
Plasmid#67406PurposeMammalian expression of hArl14 with C-term GFP tagDepositorInsertARL14 (ARL14 Human)
TagsGFPExpressionMammalianMutationbp 172 C to T; aa L58FPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARFRP1-GFP
Plasmid#67408PurposeMammalian expression of hArfrp with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF1-GFP
Plasmid#67390PurposeMammalian expression of hArf1 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL11-GFP
Plasmid#67407PurposeMammalian expression of hArl11 with C-term GFP tagDepositorInsertARL11 (ARL11 Human)
TagsGFPExpressionMammalianMutationbp 442 T to C; aa C148RPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4-GFP
Plasmid#67398PurposeMammalian expression of hArl4 with C-term GFP tagDepositorInsertARL4 (ARL4A Human)
TagsGFPExpressionMammalianMutationbp 105 A to T; silent mutationPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF4-GFP
Plasmid#67392PurposeMammalian expression of hArf4 with C-term GFP tagDepositorInsertARF4 (ARF4 Human)
TagsGFPExpressionMammalianMutationV53A, L123P and M134I mutations were unintended P…PromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF3-GFP
Plasmid#67391PurposeMammalian expression of hArf3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-moxGFP
Plasmid#227273PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-moxGFP cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro-moxGFP
Plasmid#227275PurposeAAVS1 targeting donor for the insertion of Puro and a medium strength PGK expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-PGK-moxGFP cassette (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1584 - pscAAV CMV-IE secreted EGFP-THPKTEL WPRE
Plasmid#188539PurposeAn AAV packaging vector that expresses secreted C-CDNF under control of the EGFP promoter.DepositorInsertsecreted EGFP
UseAAVTagsCDNF(1-28) and THPKTEL WPREPromoterCMV-IEAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + mMALAT1_3'
Plasmid#91803PurposeExpresses a cGFP mRNA that ends in the MALAT1 triple helix when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG
Plasmid#85225PurposeExpresses TVA, EGFP, and optimized Rabies G (oG) protein in a FLEX cassetteDepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV1-SMAC-HA-eGFP
Plasmid#67487PurposeTargets HA-eGFP to mitochondrial intermembrane space (IMS)DepositorInsertSMAC (DIABLO Human)
TagsHA-eGFPExpressionMammalianMutationaa1-59Promoterattenuated CMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-SMAC-HA-eGFP
Plasmid#67490PurposeTargets HA-eGFP to mitochondrial intermembrane space (IMS)DepositorInsertSMAC (DIABLO Human)
TagsHA-eGFPExpressionMammalianMutationaa1-59Promoterattenuated CMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-SMAC-HA-eGFP
Plasmid#67492PurposeTargets HA-eGFP to mitochondrial intermembrane space (IMS)DepositorInsertSMAC (DIABLO Human)
TagsHA-eGFPExpressionMammalianMutationaa1-59Promoterattenuated CMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV3-SMAC-HA-eGFP
Plasmid#67489PurposeTargets HA-eGFP to mitochondrial intermembrane space (IMS)DepositorInsertSMAC (DIABLO Human)
TagsHA-eGFPExpressionMammalianMutationaa1-59Promoterattenuated CMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV2-SMAC-HA-eGFP
Plasmid#67488PurposeTargets HA-eGFP to mitochondrial intermembrane space (IMS)DepositorInsertSMAC (DIABLO Human)
TagsHA-eGFPExpressionMammalianMutationaa1-59Promoterattenuated CMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-SMAC-HA-eGFP
Plasmid#67491PurposeTargets HA-eGFP to mitochondrial intermembrane space (IMS)DepositorInsertSMAC (DIABLO Human)
TagsHA-eGFPExpressionMammalianMutationaa1-59Promoterattenuated CMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-EGFP
Plasmid#106964Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralExpressionMammalianPromoterEFSAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-H2B-sfGFP-T2A-iCre
Plasmid#183351PurposeHistone H2B-sfGFP and iCre recombinaseDepositorInsertHistone H2B-sfGFP-T2A-iCre
UseCre/LoxExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
integrin beta6 EGFP pWZL Blast2
Plasmid#13591DepositorAvailable SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-sfGFP-GSAx9-iCre-ERT2
Plasmid#137857PurposeCAG-sfGFP-GSAx9-iCre-ERT2 piggyBac transposonDepositorInsertsfGFP-GSAx9-iCre-ERT2
UseCre/Lox; PiggybacExpressionMammalianAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-HA
Plasmid#242768PurposeAAV transfer plasmid expressing eGFP-HA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHAPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-E2
Plasmid#242766PurposeAAV transfer plasmid expressing eGFP-E2 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsE2PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-S1
Plasmid#242775PurposeAAV transfer plasmid expressing eGFP-S1 under a CAG promoter.DepositorInsertEGFP
UseAAVTagsS1PromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
XE85 Delta Beta-catenin in GFP
Plasmid#16835DepositorInsertDelta beta-catenin GFP (ctnnb1.L Frog)
UseXenopus expressionTagsGFPMutationThese PCR fragments have the first 138 bp after t…Available SinceMarch 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9_GFP
Plasmid#64709PurposeCo-expression of human codon-optimized Staphylococcus aureus Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells and other mammalian cellsDepositorInsertSaCas9-2A-GFP
UseCRISPRTags2A-GFP and 3xFLAG-SV40 NLSExpressionMammalianPromoterCAGAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pETcLIC-GFP
Plasmid#183514PurposeThe plasmid contains LIC cassette upstream of folding reporter GFP and TEV-cleavable 10x histidine purification tag. Compatible with T7 promoter-based expression system in E. coliDepositorTypeEmpty backboneTags10x His-tag and folding reporter GFPExpressionBacterialPromoterT7 lacAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYUBcLIC-GFP
Plasmid#183509PurposeThe plasmid contains LIC cassette upstream of folding reporter GFP and TEV-cleavable 10x histidine purification tag. Compatible with T7 promoter-based expression system in mycobacteria.DepositorTypeEmpty backboneTags10x His-tag and folding reporter GFPExpressionBacterialPromoterT7 lacAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1P_EGFP
Plasmid#232171PurposeEGFP expression under the control of the human Synapsin-1 promoterDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBluescript II NLS-MC-EGFP-tdTomato (pBET2)
Plasmid#240411PurposeThis plasmid facilitates the assessment of MMR proficiency in human living cellsDepositorInsertNLS-EGFP fusion protein
ExpressionMammalianPromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-T2A-sfGFP-3xP3-RFP
Plasmid#127557PurposeCRISPaint universal donor plasmid for gene exon insertion. Encodes T2A-sfGFP-SV40 and 3xP3-RFP visible eye marker.DepositorInsertsfGFP
UseCRISPRExpressionInsectAvailable SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVSVΔG-eGFP-linker
Plasmid#231707PurposeEncodes the genome of VSV driven by a T7 polymerase promoter. It lacks the G protein (glycoprotein) and encodes eGFP.DepositorInsertVSV antigenome
UseVsv expressionExpressionMammalianMutationΔG (VSV glycoprotein removed)PromoterT7Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG-GFP-PM-TurboID
Plasmid#209402PurposeTransiently expressing and visualizing the subcellular localization of TurboID fused with a plasma menbrane targeting peptide in plantaDepositorInsertcTP-3XHA-TurboID
TagsGFPExpressionPlantPromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
IO001: pMVP (R4-R3) eGFP
Plasmid#121730PurposepMVP R4-R3 entry plasmid, contains eGFP for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInserteGFP
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-19:LAMP1-mEGFP
Plasmid#101782PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human LAMP1DepositorInsertLAMP1 Homology Arms with linker-mEGFP (LAMP1 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianAvailable SinceNov. 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
MCP-EGFP-PiggyBac
Plasmid#190003PurposeExpression of MCP-EGFP in mammalian cells. To clone this plasmid, Addgene plasmid #119908 was used. We replaced the tandem coat proteins and double tagRFP with a single coat protein fused to EGFP.DepositorInsertMCP-EGFP
Available SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AcGFP-progerin
Plasmid#86947PurposeConstruct used to synthesize progerin mRNA. Please note the plasmid contains LMNA gene with nucleotide C1824T mutation.DepositorInsertAcGFP-progerin (LMNA Human)
UseAAVTagsAcGFPExpressionMammalianMutationprogerin sequence is LMNA gene with nucleotide C1…PromoterCMV and T7Available SinceJune 7, 2017AvailabilityAcademic Institutions and Nonprofits only