We narrowed to 12,110 results for: NSI
-
Plasmid#27628DepositorInsertmouse myc ULK1 4SA (Myc Mouse)
UseRetroviralTagsmycMutationS467A, S555A, T574A, S637A. Initial M from ULK1 r…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 NSP8_nostop
Plasmid#149311PurposeGateway-compatible Entry vector, with insert of NSP8 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertNSP8 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTol2-UAS-zArchon2-KGC-EGFP-ER2
Plasmid#108428PurposeCodon-optimized Archon2 fluorescent voltage reporter in zebrafish expression plasmidDepositorInsertzArchon2-KGC-EGFP-ER2
UseZebrafishPromoterUASAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
hSyn ArcLightCo (Q239)-T2A-nls-mCherry
Plasmid#85844PurposeGenetically encoded voltage sensor ArcLight- codon optimizedDepositorInsertArcLightCo-Q239
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterhSyn1Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EZH2_EZH1SET-PGK-Puro-IRES-GFP
Plasmid#75126PurposeRetroviral expression plasmid encoding a human EZH2 SET-domain-swap mutant containing the EZH1 SET domainDepositorInsertKMT6 (EZH2 Human)
UseRetroviralTagsNoneMutationSET domain replaced with the SET domain of EZH1Available SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.VSVg_NGFR
Plasmid#158241PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426-Cup1p-FUS-FusionRed
Plasmid#188393PurposeCu2+-dependent expression of N-terminal FUS fused with red fluorescent protein in yeast cellsDepositorAvailable SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD86-ST3-His
Plasmid#210664PurposeExpression of the extracellular domain of human CD86 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD86 fused to Spytag003 and Histag (CD86 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG_FBXL7 (R310H)
Plasmid#171849PurposepcDNA3-FLAG_FBXL7 (R310H)DepositorInsertF-box and leucine rich repeat protein 7 (FBXL7 Human)
TagsFlagExpressionMammalianMutationchanged Arginine 310 to HistidineAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 Luciferase
Plasmid#117072Purposesingle guide RNA targeting LuciferaseDepositorInsertLuciferase
UseCRISPRPromoterhU6Available SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP2A-V12-neo
Plasmid#156178PurposeLentiviral vector for expression of RAP2A-V12, with neomycin selectionDepositorInsertRAP2A (RAP2A Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 12 to ValinePromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-flag-RAP1B-V12-neo
Plasmid#156175PurposeLentiviral vector for expression of flag-RAP1B-V12, with neomycin selectionDepositorInsertRAP1B (RAP1B Bovine)
UseLentiviralTags2xFLAGExpressionMammalianMutationchanged Glycine 12 to ValinePromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-flag-RAP1B-N17-neo
Plasmid#156176PurposeLentiviral vector for expression of flag-RAP1B-N17, with neomycin selectionDepositorInsertRAP1B (RAP1B Bovine)
UseLentiviralTags2xFLAGExpressionMammalianMutationchanged Serine 17 to AsparaginePromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
HisGB1-CITED2(216-269)+CBPTAZ1(340-439)
Plasmid#173761PurposeBacterial coexpression of human CITED2 CTAD with CBP TAZ1DepositorExpressionBacterialPromoterT7Available SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.VSVg_NGFR
Plasmid#158232PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIN- myc ULK1 K46I
Plasmid#27627DepositorInsertmouse myc ULK1 K46I (Myc Mouse)
UseRetroviralTagsmycMutationInitial M from ULK1 removed. Silent mutation at A…Available SinceApril 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.VSVg_NGFR
Plasmid#158239PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP-H2B-C1
Plasmid#108411PurposeHistone 2B fused to monomeric near-infrared fluorescent protein miRFPDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(5’UTR)-SL-FF
Plasmid#85491PurposeFirefly luciferase under the control of ATP5O 5'UTR followed by a stem-loopDepositorInsert5'UTR of ATP5O followed by stem loop (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianAvailable SinceJan. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP2A-N17-neo
Plasmid#156179PurposeLentiviral vector for expression of RAP2A-N17, with neomycin selectionDepositorInsertRAP2A (RAP2A Human)
UseLentiviralExpressionMammalianMutationchanged Serine 17 to AsparaginePromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.FLAG_NGFR
Plasmid#158240PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.VSVg_NGFR
Plasmid#158246PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.FLAG.VSVg_NGFR
Plasmid#158247PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.FLAG_NGFR
Plasmid#158251PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 S 24nt-del
Plasmid#153952PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 23, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 S 24nt-del_nostop
Plasmid#153953PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO_S.V5.HA_NGFR
Plasmid#158339PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.C_NGFR
Plasmid#158314PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 - myc ULK1 k46I
Plasmid#27624DepositorInsertmouse myc ULK1 K46I (Myc Mouse)
UseGateway donr vectorTagsmycMutationInitial M from ULK1 removed. Silent mutation at A…Available SinceFeb. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.V5_NGFR
Plasmid#158235PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.V5MutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7a (closed)
Plasmid#160101PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HES3
Plasmid#101411PurposeDonor Vector containing HES3 transcription factor, part of the Human TFome CollectionDepositorInsertHES3 (HES3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 - myc ULK1 4SA
Plasmid#27625DepositorInsertmouse myc ULK1 4SA (Myc Mouse)
UseGateway donr vectorTagsmycMutationS467A, S555A, T574A, S637A. Initial M from ULK1 r…Available SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 ORF7B C-trunc_nostop
Plasmid#153956PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 11, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 ORF7B C-trunc
Plasmid#153957PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
BRI1 BRI1_pECIA2
Plasmid#115086PurposeBait vector BRI1 BRI1_pECIA2 should be used with prey vector BRI1 BRI1_pECIA14.DepositorInsertAT4G39400 (BRI1 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
IMPT-10917
Plasmid#236192PurposeExpress GPR6 in insect cellsDepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits